Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630860_at:

>probe:Drosophila_2:1630860_at:212:157; Interrogation_Position=3062; Antisense; ACACGAGTTCCTTGAGCGCGTCAAA
>probe:Drosophila_2:1630860_at:309:609; Interrogation_Position=3074; Antisense; TGAGCGCGTCAAACTCGAGGGCAGT
>probe:Drosophila_2:1630860_at:233:519; Interrogation_Position=3097; Antisense; GTGGAGGAGCCACTTATGCCATGTA
>probe:Drosophila_2:1630860_at:156:659; Interrogation_Position=3120; Antisense; TAAGCATAGAATACATTGGGCGCGC
>probe:Drosophila_2:1630860_at:670:727; Interrogation_Position=3135; Antisense; TTGGGCGCGCTACAGAAATCTCTAA
>probe:Drosophila_2:1630860_at:311:149; Interrogation_Position=3162; Antisense; ACTTGAAGCCAAGTCGCAATCCGGC
>probe:Drosophila_2:1630860_at:394:319; Interrogation_Position=3185; Antisense; GCTCGGGTGACCAGACTTAGACATC
>probe:Drosophila_2:1630860_at:685:703; Interrogation_Position=3201; Antisense; TTAGACATCTCTGTTGCACAACCGA
>probe:Drosophila_2:1630860_at:163:597; Interrogation_Position=3244; Antisense; TGTGCTGTAACTGCATAGCTGGTTA
>probe:Drosophila_2:1630860_at:694:655; Interrogation_Position=3318; Antisense; TAACCGATAGCCGTTTTTATAGAAG
>probe:Drosophila_2:1630860_at:279:107; Interrogation_Position=3400; Antisense; AGAAATTCGCATTAGGCAGCCAAGC
>probe:Drosophila_2:1630860_at:426:239; Interrogation_Position=3430; Antisense; AATACTCAATGGGTGTGTTTTCAAA
>probe:Drosophila_2:1630860_at:102:239; Interrogation_Position=3454; Antisense; AATCTGTTATTTGGTTTGCGAACTC
>probe:Drosophila_2:1630860_at:430:169; Interrogation_Position=3488; Antisense; AAAGGTGCCTCTAAACGTATGCAAT

Paste this into a BLAST search page for me
ACACGAGTTCCTTGAGCGCGTCAAATGAGCGCGTCAAACTCGAGGGCAGTGTGGAGGAGCCACTTATGCCATGTATAAGCATAGAATACATTGGGCGCGCTTGGGCGCGCTACAGAAATCTCTAAACTTGAAGCCAAGTCGCAATCCGGCGCTCGGGTGACCAGACTTAGACATCTTAGACATCTCTGTTGCACAACCGATGTGCTGTAACTGCATAGCTGGTTATAACCGATAGCCGTTTTTATAGAAGAGAAATTCGCATTAGGCAGCCAAGCAATACTCAATGGGTGTGTTTTCAAAAATCTGTTATTTGGTTTGCGAACTCAAAGGTGCCTCTAAACGTATGCAAT

Full Affymetrix probeset data:

Annotations for 1630860_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime