FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630861_at:

>probe:Drosophila_2:1630861_at:675:145; Interrogation_Position=1008; Antisense; ACTCGCACTTCTATTCAGTCTGAGG
>probe:Drosophila_2:1630861_at:498:323; Interrogation_Position=1118; Antisense; GCGCCGCTGAGTGCAATTTTGTATA
>probe:Drosophila_2:1630861_at:629:599; Interrogation_Position=1201; Antisense; TGTATGTGTGTGTTTAGGCCTAAGC
>probe:Drosophila_2:1630861_at:127:707; Interrogation_Position=1233; Antisense; TTAAATATCCATTTCCGTGGCCGGG
>probe:Drosophila_2:1630861_at:208:99; Interrogation_Position=1261; Antisense; AGATGTGTACTTACCTGACAGCCCT
>probe:Drosophila_2:1630861_at:436:133; Interrogation_Position=704; Antisense; ACCCAGTTCGCGGAGTGCGTGAAAA
>probe:Drosophila_2:1630861_at:480:509; Interrogation_Position=722; Antisense; GTGAAAAACGACTGGCGCACCTGCT
>probe:Drosophila_2:1630861_at:158:149; Interrogation_Position=767; Antisense; ACTATATTCCTGCTGCTTTTTCTCA
>probe:Drosophila_2:1630861_at:600:125; Interrogation_Position=791; Antisense; ACCTTTGAGGGCCTTATGTTCGGCA
>probe:Drosophila_2:1630861_at:721:471; Interrogation_Position=808; Antisense; GTTCGGCATATTCACCATCATCATG
>probe:Drosophila_2:1630861_at:663:117; Interrogation_Position=843; Antisense; AGCTGACGGCTATCCTAAACGATCA
>probe:Drosophila_2:1630861_at:609:211; Interrogation_Position=911; Antisense; AAGAAATCGCGCCTCAAGAGCATCC
>probe:Drosophila_2:1630861_at:205:213; Interrogation_Position=926; Antisense; AAGAGCATCCAGTCGGTGTTCGGAC
>probe:Drosophila_2:1630861_at:82:573; Interrogation_Position=961; Antisense; GGCCTGGTTTTCACCATTCACGGAG

Paste this into a BLAST search page for me
ACTCGCACTTCTATTCAGTCTGAGGGCGCCGCTGAGTGCAATTTTGTATATGTATGTGTGTGTTTAGGCCTAAGCTTAAATATCCATTTCCGTGGCCGGGAGATGTGTACTTACCTGACAGCCCTACCCAGTTCGCGGAGTGCGTGAAAAGTGAAAAACGACTGGCGCACCTGCTACTATATTCCTGCTGCTTTTTCTCAACCTTTGAGGGCCTTATGTTCGGCAGTTCGGCATATTCACCATCATCATGAGCTGACGGCTATCCTAAACGATCAAAGAAATCGCGCCTCAAGAGCATCCAAGAGCATCCAGTCGGTGTTCGGACGGCCTGGTTTTCACCATTCACGGAG

Full Affymetrix probeset data:

Annotations for 1630861_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720