FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630866_at:

>probe:Drosophila_2:1630866_at:234:545; Interrogation_Position=2613; Antisense; GGATCAGCAGCCATCAGTCGTGGTG
>probe:Drosophila_2:1630866_at:97:501; Interrogation_Position=2629; Antisense; GTCGTGGTGCATCCGATCCTAAGGA
>probe:Drosophila_2:1630866_at:319:385; Interrogation_Position=2652; Antisense; GAACATTTGCATTTTCTACAGCCAA
>probe:Drosophila_2:1630866_at:560:449; Interrogation_Position=2680; Antisense; GATCCGAAGAAGTACAGCGCTATAT
>probe:Drosophila_2:1630866_at:227:123; Interrogation_Position=2695; Antisense; AGCGCTATATTCTACGACTACCATC
>probe:Drosophila_2:1630866_at:587:431; Interrogation_Position=2805; Antisense; GAGTCTGGCACCACGCAGCGATGAT
>probe:Drosophila_2:1630866_at:84:437; Interrogation_Position=2851; Antisense; GAGGATTCGTATAACCACCAGCACA
>probe:Drosophila_2:1630866_at:399:565; Interrogation_Position=2886; Antisense; GGCCATTCCGAAGCCCTTGAAGGAG
>probe:Drosophila_2:1630866_at:119:631; Interrogation_Position=2967; Antisense; TCCGAGGACGGGACGCAAACTGCGC
>probe:Drosophila_2:1630866_at:4:179; Interrogation_Position=2983; Antisense; AAACTGCGCGTTCGCTCCAATGCGA
>probe:Drosophila_2:1630866_at:386:231; Interrogation_Position=3001; Antisense; AATGCGAGGCTGCTGCTCACGGACT
>probe:Drosophila_2:1630866_at:226:77; Interrogation_Position=3053; Antisense; AGGATGTAAACTGCTGCGAGGACGA
>probe:Drosophila_2:1630866_at:603:497; Interrogation_Position=3140; Antisense; GTCTAGGCATTATTCATACATCCAA
>probe:Drosophila_2:1630866_at:411:459; Interrogation_Position=3170; Antisense; GATTTTGGAATTTCCGGCCAACGAT

Paste this into a BLAST search page for me
GGATCAGCAGCCATCAGTCGTGGTGGTCGTGGTGCATCCGATCCTAAGGAGAACATTTGCATTTTCTACAGCCAAGATCCGAAGAAGTACAGCGCTATATAGCGCTATATTCTACGACTACCATCGAGTCTGGCACCACGCAGCGATGATGAGGATTCGTATAACCACCAGCACAGGCCATTCCGAAGCCCTTGAAGGAGTCCGAGGACGGGACGCAAACTGCGCAAACTGCGCGTTCGCTCCAATGCGAAATGCGAGGCTGCTGCTCACGGACTAGGATGTAAACTGCTGCGAGGACGAGTCTAGGCATTATTCATACATCCAAGATTTTGGAATTTCCGGCCAACGAT

Full Affymetrix probeset data:

Annotations for 1630866_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720