FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630867_at:

>probe:Drosophila_2:1630867_at:718:547; Interrogation_Position=153; Antisense; GGATGTCTCCAATGCGGTAGGACTT
>probe:Drosophila_2:1630867_at:30:563; Interrogation_Position=203; Antisense; GGAAGAGTCTGCGTAACAACTACCG
>probe:Drosophila_2:1630867_at:255:659; Interrogation_Position=231; Antisense; TAAGATCCACCAAGGCAACGCCTGG
>probe:Drosophila_2:1630867_at:307:229; Interrogation_Position=276; Antisense; AATGGAGTTCGTTCGCGATGTCTTC
>probe:Drosophila_2:1630867_at:578:299; Interrogation_Position=326; Antisense; CGCGTTGCCGTGTTCAGGTGAAGAA
>probe:Drosophila_2:1630867_at:21:111; Interrogation_Position=352; Antisense; AGCAAGCTAATTCTACATCCGCAAC
>probe:Drosophila_2:1630867_at:666:161; Interrogation_Position=375; Antisense; ACAATATCTGCAATCGGTGGCGAGC
>probe:Drosophila_2:1630867_at:478:531; Interrogation_Position=390; Antisense; GGTGGCGAGCTATTCGGCATTCAAA
>probe:Drosophila_2:1630867_at:717:97; Interrogation_Position=443; Antisense; AGAGACTCTTTCTGGTTACGGACGA
>probe:Drosophila_2:1630867_at:470:555; Interrogation_Position=462; Antisense; GGACGAGCCGGCATTCGATCTGGAT
>probe:Drosophila_2:1630867_at:12:415; Interrogation_Position=501; Antisense; GACCAGGCTATTGGGCACCGATCAA
>probe:Drosophila_2:1630867_at:270:127; Interrogation_Position=538; Antisense; ACCAATCTGGACTTCATACTACTGC
>probe:Drosophila_2:1630867_at:57:123; Interrogation_Position=661; Antisense; AGCGATCGCAGCAAGGAACGTTTCC
>probe:Drosophila_2:1630867_at:43:383; Interrogation_Position=676; Antisense; GAACGTTTCCGCAGTTGGACACGGC

Paste this into a BLAST search page for me
GGATGTCTCCAATGCGGTAGGACTTGGAAGAGTCTGCGTAACAACTACCGTAAGATCCACCAAGGCAACGCCTGGAATGGAGTTCGTTCGCGATGTCTTCCGCGTTGCCGTGTTCAGGTGAAGAAAGCAAGCTAATTCTACATCCGCAACACAATATCTGCAATCGGTGGCGAGCGGTGGCGAGCTATTCGGCATTCAAAAGAGACTCTTTCTGGTTACGGACGAGGACGAGCCGGCATTCGATCTGGATGACCAGGCTATTGGGCACCGATCAAACCAATCTGGACTTCATACTACTGCAGCGATCGCAGCAAGGAACGTTTCCGAACGTTTCCGCAGTTGGACACGGC

Full Affymetrix probeset data:

Annotations for 1630867_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720