FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630872_at:

>probe:Drosophila_2:1630872_at:657:499; Interrogation_Position=1073; Antisense; GTCTGCAAACCTGTTTTGATCTTCA
>probe:Drosophila_2:1630872_at:32:37; Interrogation_Position=1139; Antisense; ATCAGGAGTGCGGATGTCCTTTCGC
>probe:Drosophila_2:1630872_at:391:717; Interrogation_Position=1159; Antisense; TTCGCACTGGATTTCTTCTTCTGTA
>probe:Drosophila_2:1630872_at:9:641; Interrogation_Position=1175; Antisense; TCTTCTGTACCGTGCTAAATTCCAT
>probe:Drosophila_2:1630872_at:512:663; Interrogation_Position=1190; Antisense; TAAATTCCATTAGCTGCGTTCAGTA
>probe:Drosophila_2:1630872_at:205:663; Interrogation_Position=662; Antisense; TAAAGTACTCCCAACCGGAGCAGCA
>probe:Drosophila_2:1630872_at:615:639; Interrogation_Position=717; Antisense; TCGGCTGCTGCGGATCTATGCAAAA
>probe:Drosophila_2:1630872_at:150:459; Interrogation_Position=760; Antisense; GATATCAAAGTGCTCTGGCTTCCAG
>probe:Drosophila_2:1630872_at:695:115; Interrogation_Position=790; Antisense; AGCATGCTCTTCTCGAACATTGTTG
>probe:Drosophila_2:1630872_at:194:369; Interrogation_Position=844; Antisense; GAATGGATATTTTTCCACCGCCGTA
>probe:Drosophila_2:1630872_at:482:287; Interrogation_Position=900; Antisense; CTGGAAATATCTGGGCGGCGGACTT
>probe:Drosophila_2:1630872_at:49:151; Interrogation_Position=921; Antisense; ACTTGCCCCTTTGTTGAGGATGCTA
>probe:Drosophila_2:1630872_at:713:435; Interrogation_Position=936; Antisense; GAGGATGCTACTAATTGGTCTTTGT
>probe:Drosophila_2:1630872_at:513:543; Interrogation_Position=984; Antisense; GGATTTTCTCAATTTACAGCTTCTG

Paste this into a BLAST search page for me
GTCTGCAAACCTGTTTTGATCTTCAATCAGGAGTGCGGATGTCCTTTCGCTTCGCACTGGATTTCTTCTTCTGTATCTTCTGTACCGTGCTAAATTCCATTAAATTCCATTAGCTGCGTTCAGTATAAAGTACTCCCAACCGGAGCAGCATCGGCTGCTGCGGATCTATGCAAAAGATATCAAAGTGCTCTGGCTTCCAGAGCATGCTCTTCTCGAACATTGTTGGAATGGATATTTTTCCACCGCCGTACTGGAAATATCTGGGCGGCGGACTTACTTGCCCCTTTGTTGAGGATGCTAGAGGATGCTACTAATTGGTCTTTGTGGATTTTCTCAATTTACAGCTTCTG

Full Affymetrix probeset data:

Annotations for 1630872_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720