FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630875_at:

>probe:Drosophila_2:1630875_at:528:189; Interrogation_Position=409; Antisense; AACAGTTTTGTGAGCACTCCTGCAA
>probe:Drosophila_2:1630875_at:95:527; Interrogation_Position=447; Antisense; GGGCACTCGAACCTCGGAGTTTATC
>probe:Drosophila_2:1630875_at:420:549; Interrogation_Position=462; Antisense; GGAGTTTATCCGTACACCAATTGCA
>probe:Drosophila_2:1630875_at:591:7; Interrogation_Position=498; Antisense; ATTGCCCATGCAGTACTTCCGAAAG
>probe:Drosophila_2:1630875_at:637:635; Interrogation_Position=541; Antisense; TCGATGTCATATCCGGAATTCCTCC
>probe:Drosophila_2:1630875_at:524:361; Interrogation_Position=556; Antisense; GAATTCCTCCGCTGGAACGAGGCAG
>probe:Drosophila_2:1630875_at:84:139; Interrogation_Position=572; Antisense; ACGAGGCAGCTTTCTATGGCGGAGA
>probe:Drosophila_2:1630875_at:522:231; Interrogation_Position=687; Antisense; AATGAATCTTCGCATGTTCCGGCAG
>probe:Drosophila_2:1630875_at:113:549; Interrogation_Position=780; Antisense; GGAGGACGACGACATATCCGCCTTG
>probe:Drosophila_2:1630875_at:533:585; Interrogation_Position=809; Antisense; TGGGCCCCGAACTGGAAGTACTCGA
>probe:Drosophila_2:1630875_at:616:487; Interrogation_Position=826; Antisense; GTACTCGACGAGAGCCCCAATGAAG
>probe:Drosophila_2:1630875_at:726:213; Interrogation_Position=857; Antisense; AAGAGGTCGCAGGTTCTGGTCACTC
>probe:Drosophila_2:1630875_at:703:267; Interrogation_Position=896; Antisense; CAGGCTTTGGAATCCTTGGCCAGCG
>probe:Drosophila_2:1630875_at:450:7; Interrogation_Position=976; Antisense; ATTCGCCGGGTGCAGTACGTCAGAA

Paste this into a BLAST search page for me
AACAGTTTTGTGAGCACTCCTGCAAGGGCACTCGAACCTCGGAGTTTATCGGAGTTTATCCGTACACCAATTGCAATTGCCCATGCAGTACTTCCGAAAGTCGATGTCATATCCGGAATTCCTCCGAATTCCTCCGCTGGAACGAGGCAGACGAGGCAGCTTTCTATGGCGGAGAAATGAATCTTCGCATGTTCCGGCAGGGAGGACGACGACATATCCGCCTTGTGGGCCCCGAACTGGAAGTACTCGAGTACTCGACGAGAGCCCCAATGAAGAAGAGGTCGCAGGTTCTGGTCACTCCAGGCTTTGGAATCCTTGGCCAGCGATTCGCCGGGTGCAGTACGTCAGAA

Full Affymetrix probeset data:

Annotations for 1630875_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720