Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630878_a_at:

>probe:Drosophila_2:1630878_a_at:380:361; Interrogation_Position=1043; Antisense; GCAAGGTCCTTATCCTTCACAGAGA
>probe:Drosophila_2:1630878_a_at:460:49; Interrogation_Position=501; Antisense; ATGCCAGCACTGGAGTTTCCATCAT
>probe:Drosophila_2:1630878_a_at:468:645; Interrogation_Position=522; Antisense; TCATGAAAATCGAACCTCACCGGTT
>probe:Drosophila_2:1630878_a_at:528:521; Interrogation_Position=578; Antisense; GTGGCTATTAATCCCGATGTCTTCA
>probe:Drosophila_2:1630878_a_at:294:347; Interrogation_Position=613; Antisense; GCATGCATCTTTGGCGTCGCTAGGA
>probe:Drosophila_2:1630878_a_at:616:553; Interrogation_Position=635; Antisense; GGAGCCGAGTTACTTGTGGATACTA
>probe:Drosophila_2:1630878_a_at:394:117; Interrogation_Position=716; Antisense; AGCTATGCTCCCAAGATTACCAGTA
>probe:Drosophila_2:1630878_a_at:519:503; Interrogation_Position=760; Antisense; GTCCGAGCTGAGTGCCATTGAAATA
>probe:Drosophila_2:1630878_a_at:677:145; Interrogation_Position=788; Antisense; ACTCGTCATCGAGCTTTGTATGGCT
>probe:Drosophila_2:1630878_a_at:252:95; Interrogation_Position=852; Antisense; AGTTGCTGGAGTTGCGATTACCGGA
>probe:Drosophila_2:1630878_a_at:516:77; Interrogation_Position=881; Antisense; AGAGTTCCCGTCCAAGAACCTGGTG
>probe:Drosophila_2:1630878_a_at:483:535; Interrogation_Position=902; Antisense; GGTGCCATCAGCTACCTAAGGAAGT
>probe:Drosophila_2:1630878_a_at:28:561; Interrogation_Position=921; Antisense; GGAAGTCGAGATCCCTCATAATCGG
>probe:Drosophila_2:1630878_a_at:523:563; Interrogation_Position=967; Antisense; GGAAGTGCTTCAGTTACGCGTGGAA

Paste this into a BLAST search page for me
GCAAGGTCCTTATCCTTCACAGAGAATGCCAGCACTGGAGTTTCCATCATTCATGAAAATCGAACCTCACCGGTTGTGGCTATTAATCCCGATGTCTTCAGCATGCATCTTTGGCGTCGCTAGGAGGAGCCGAGTTACTTGTGGATACTAAGCTATGCTCCCAAGATTACCAGTAGTCCGAGCTGAGTGCCATTGAAATAACTCGTCATCGAGCTTTGTATGGCTAGTTGCTGGAGTTGCGATTACCGGAAGAGTTCCCGTCCAAGAACCTGGTGGGTGCCATCAGCTACCTAAGGAAGTGGAAGTCGAGATCCCTCATAATCGGGGAAGTGCTTCAGTTACGCGTGGAA

Full Affymetrix probeset data:

Annotations for 1630878_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime