FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630881_at:

>probe:Drosophila_2:1630881_at:481:699; Interrogation_Position=1298; Antisense; TTTATTCGCCGCACTGAGGATGAGA
>probe:Drosophila_2:1630881_at:102:245; Interrogation_Position=1361; Antisense; AATTTCTTGGTCTTGTCAGTGCTCA
>probe:Drosophila_2:1630881_at:431:207; Interrogation_Position=1385; Antisense; AAGCACCGGTATCCCAACATTTTTG
>probe:Drosophila_2:1630881_at:156:525; Interrogation_Position=1410; Antisense; GGGCTTCCCAGTTGAATAAGGCCAA
>probe:Drosophila_2:1630881_at:464:659; Interrogation_Position=1447; Antisense; TAAGCCCCTGGAACCATACAGTATC
>probe:Drosophila_2:1630881_at:374:423; Interrogation_Position=1484; Antisense; GAGAAGCTGTGCATGTCGCGCCTGA
>probe:Drosophila_2:1630881_at:194:435; Interrogation_Position=1526; Antisense; GAGGGCAAGTCATTCCCCATGAACA
>probe:Drosophila_2:1630881_at:105:249; Interrogation_Position=1579; Antisense; CAATCTGATGGCTGTGTTCTTGCTG
>probe:Drosophila_2:1630881_at:611:335; Interrogation_Position=1600; Antisense; GCTGCGCAAGCATTTACGTGACTAT
>probe:Drosophila_2:1630881_at:84:551; Interrogation_Position=1654; Antisense; GGAGTTCTTTACCATGCCGTGGGAC
>probe:Drosophila_2:1630881_at:25:21; Interrogation_Position=1696; Antisense; ATTTGTGTTCACCTAAGCTCATTCC
>probe:Drosophila_2:1630881_at:180:47; Interrogation_Position=1728; Antisense; ATCCACGGCCGTATGCTTAGATTTA
>probe:Drosophila_2:1630881_at:276:493; Interrogation_Position=1768; Antisense; GTAATTTTTGCCTTCTGACTGCTTA
>probe:Drosophila_2:1630881_at:3:127; Interrogation_Position=1815; Antisense; AGCCGGGTAGCTGGTGTCTTCTGAA

Paste this into a BLAST search page for me
TTTATTCGCCGCACTGAGGATGAGAAATTTCTTGGTCTTGTCAGTGCTCAAAGCACCGGTATCCCAACATTTTTGGGGCTTCCCAGTTGAATAAGGCCAATAAGCCCCTGGAACCATACAGTATCGAGAAGCTGTGCATGTCGCGCCTGAGAGGGCAAGTCATTCCCCATGAACACAATCTGATGGCTGTGTTCTTGCTGGCTGCGCAAGCATTTACGTGACTATGGAGTTCTTTACCATGCCGTGGGACATTTGTGTTCACCTAAGCTCATTCCATCCACGGCCGTATGCTTAGATTTAGTAATTTTTGCCTTCTGACTGCTTAAGCCGGGTAGCTGGTGTCTTCTGAA

Full Affymetrix probeset data:

Annotations for 1630881_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720