Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630883_at:

>probe:Drosophila_2:1630883_at:196:105; Interrogation_Position=10015; Antisense; AGAATAATTCTAGCGTCGAACCGAT
>probe:Drosophila_2:1630883_at:285:201; Interrogation_Position=10032; Antisense; GAACCGATATAATAACCAACGCCGA
>probe:Drosophila_2:1630883_at:387:367; Interrogation_Position=10055; Antisense; GAATCGACAGCAACACCAGACAACA
>probe:Drosophila_2:1630883_at:655:65; Interrogation_Position=9590; Antisense; ATGGTAGTACTGACCGTGGCTCACA
>probe:Drosophila_2:1630883_at:539:571; Interrogation_Position=9607; Antisense; GGCTCACAACACGAAGACCAAATTA
>probe:Drosophila_2:1630883_at:384:163; Interrogation_Position=9626; Antisense; AAATTAATCGATCTCTTACTCTCAG
>probe:Drosophila_2:1630883_at:555:37; Interrogation_Position=9636; Antisense; ATCTCTTACTCTCAGAATTCCACGA
>probe:Drosophila_2:1630883_at:546:137; Interrogation_Position=9657; Antisense; ACGAGCAAAATTTCGATTTCCCGAT
>probe:Drosophila_2:1630883_at:92:461; Interrogation_Position=9671; Antisense; GATTTCCCGATATTTCTCAGAATTC
>probe:Drosophila_2:1630883_at:612:97; Interrogation_Position=9759; Antisense; AGATGACGATTATATGGCCGCCTAT
>probe:Drosophila_2:1630883_at:20:315; Interrogation_Position=9778; Antisense; GCCTATCGTTCTTTTGGTCCAAGCT
>probe:Drosophila_2:1630883_at:155:393; Interrogation_Position=9867; Antisense; GAAAGCTGATCTAGTACCTGTTGGA
>probe:Drosophila_2:1630883_at:204:67; Interrogation_Position=9893; Antisense; ATGGAGTATCTTCCCTAATAACAGA
>probe:Drosophila_2:1630883_at:365:569; Interrogation_Position=9963; Antisense; GGCTTATTCCAATAGCTCGAGCGCA

Paste this into a BLAST search page for me
AGAATAATTCTAGCGTCGAACCGATGAACCGATATAATAACCAACGCCGAGAATCGACAGCAACACCAGACAACAATGGTAGTACTGACCGTGGCTCACAGGCTCACAACACGAAGACCAAATTAAAATTAATCGATCTCTTACTCTCAGATCTCTTACTCTCAGAATTCCACGAACGAGCAAAATTTCGATTTCCCGATGATTTCCCGATATTTCTCAGAATTCAGATGACGATTATATGGCCGCCTATGCCTATCGTTCTTTTGGTCCAAGCTGAAAGCTGATCTAGTACCTGTTGGAATGGAGTATCTTCCCTAATAACAGAGGCTTATTCCAATAGCTCGAGCGCA

Full Affymetrix probeset data:

Annotations for 1630883_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime