Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630884_at:

>probe:Drosophila_2:1630884_at:43:225; Interrogation_Position=1742; Antisense; AAGGAGACTCAACGCCAGCTGGGTT
>probe:Drosophila_2:1630884_at:488:117; Interrogation_Position=1758; Antisense; AGCTGGGTTGGATCATGGTCATGCC
>probe:Drosophila_2:1630884_at:25:629; Interrogation_Position=1779; Antisense; TGCCACTCCGCAGCATGGAAATATT
>probe:Drosophila_2:1630884_at:122:545; Interrogation_Position=1812; Antisense; GGATCACGACTCTGTTATACCGACA
>probe:Drosophila_2:1630884_at:147:55; Interrogation_Position=1859; Antisense; ATGAATCTGTGGGTACATCTGTACT
>probe:Drosophila_2:1630884_at:664:395; Interrogation_Position=1942; Antisense; GAAATTCCCAGTTTCGTTGGCCAGA
>probe:Drosophila_2:1630884_at:378:697; Interrogation_Position=2021; Antisense; TTTTAAACAAGAGAGCCGCCCACCT
>probe:Drosophila_2:1630884_at:376:421; Interrogation_Position=2060; Antisense; GAGCACATTTTATCGCCAAGGACAG
>probe:Drosophila_2:1630884_at:397:249; Interrogation_Position=2076; Antisense; CAAGGACAGCTTGGAACTTTCTCAG
>probe:Drosophila_2:1630884_at:37:385; Interrogation_Position=2089; Antisense; GAACTTTCTCAGCTTACGTCAGGAA
>probe:Drosophila_2:1630884_at:553:687; Interrogation_Position=2143; Antisense; TATTCCCTCCTCGTCTTAAAGAAGT
>probe:Drosophila_2:1630884_at:183:711; Interrogation_Position=2177; Antisense; TTCACATTGATCAATCTGCTCCCTA
>probe:Drosophila_2:1630884_at:306:337; Interrogation_Position=2194; Antisense; GCTCCCTATGCAGATATTACTATTA
>probe:Drosophila_2:1630884_at:65:667; Interrogation_Position=2211; Antisense; TACTATTACTCGAGGACCAACGTTC

Paste this into a BLAST search page for me
AAGGAGACTCAACGCCAGCTGGGTTAGCTGGGTTGGATCATGGTCATGCCTGCCACTCCGCAGCATGGAAATATTGGATCACGACTCTGTTATACCGACAATGAATCTGTGGGTACATCTGTACTGAAATTCCCAGTTTCGTTGGCCAGATTTTAAACAAGAGAGCCGCCCACCTGAGCACATTTTATCGCCAAGGACAGCAAGGACAGCTTGGAACTTTCTCAGGAACTTTCTCAGCTTACGTCAGGAATATTCCCTCCTCGTCTTAAAGAAGTTTCACATTGATCAATCTGCTCCCTAGCTCCCTATGCAGATATTACTATTATACTATTACTCGAGGACCAACGTTC

Full Affymetrix probeset data:

Annotations for 1630884_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime