FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630885_at:

>probe:Drosophila_2:1630885_at:500:417; Interrogation_Position=1008; Antisense; GAGCGACACATCGAAGGTCCATTGT
>probe:Drosophila_2:1630885_at:638:375; Interrogation_Position=525; Antisense; GAAGCGCGACATGAAGACCTTTTTT
>probe:Drosophila_2:1630885_at:575:697; Interrogation_Position=546; Antisense; TTTTGAGGTTCTGTCGCGCCTTTAC
>probe:Drosophila_2:1630885_at:683:305; Interrogation_Position=572; Antisense; CCTGCGAGTTTTGCGCCAAGGACTT
>probe:Drosophila_2:1630885_at:427:207; Interrogation_Position=589; Antisense; AAGGACTTTCGCACCGACCTGGACG
>probe:Drosophila_2:1630885_at:135:557; Interrogation_Position=609; Antisense; GGACGTCAACCCCATCAATGTGAAC
>probe:Drosophila_2:1630885_at:492:521; Interrogation_Position=654; Antisense; GTGGCTGTGCAAGTTCCACAACCGA
>probe:Drosophila_2:1630885_at:657:177; Interrogation_Position=688; Antisense; AAACTGGGCAAACCGCTCTTCGATT
>probe:Drosophila_2:1630885_at:730:577; Interrogation_Position=745; Antisense; TGGCTAGACGGCTCCTGCGACTAGG
>probe:Drosophila_2:1630885_at:460:303; Interrogation_Position=809; Antisense; CCGTTGCAGGTTGCCATGTTGACCA
>probe:Drosophila_2:1630885_at:561:59; Interrogation_Position=824; Antisense; ATGTTGACCAGACTTTGTCCCACAT
>probe:Drosophila_2:1630885_at:350:693; Interrogation_Position=837; Antisense; TTTGTCCCACATTTTGCTCGGCTGG
>probe:Drosophila_2:1630885_at:439:177; Interrogation_Position=922; Antisense; AAACTGTGCCCTGTTTCTGGCCAGA
>probe:Drosophila_2:1630885_at:163:563; Interrogation_Position=964; Antisense; GGAACCTGCGTCAGCGTGACATTAA

Paste this into a BLAST search page for me
GAGCGACACATCGAAGGTCCATTGTGAAGCGCGACATGAAGACCTTTTTTTTTTGAGGTTCTGTCGCGCCTTTACCCTGCGAGTTTTGCGCCAAGGACTTAAGGACTTTCGCACCGACCTGGACGGGACGTCAACCCCATCAATGTGAACGTGGCTGTGCAAGTTCCACAACCGAAAACTGGGCAAACCGCTCTTCGATTTGGCTAGACGGCTCCTGCGACTAGGCCGTTGCAGGTTGCCATGTTGACCAATGTTGACCAGACTTTGTCCCACATTTTGTCCCACATTTTGCTCGGCTGGAAACTGTGCCCTGTTTCTGGCCAGAGGAACCTGCGTCAGCGTGACATTAA

Full Affymetrix probeset data:

Annotations for 1630885_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720