Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630886_at:

>probe:Drosophila_2:1630886_at:544:131; Interrogation_Position=482; Antisense; ACCGAGGTGCGCTGCTCCCGATGCT
>probe:Drosophila_2:1630886_at:100:435; Interrogation_Position=485; Antisense; GAGGTGCGCTGCTCCCGATGCTCCG
>probe:Drosophila_2:1630886_at:457:445; Interrogation_Position=501; Antisense; GATGCTCCGCCCATATGGGCCACGT
>probe:Drosophila_2:1630886_at:157:273; Interrogation_Position=512; Antisense; CATATGGGCCACGTCTTCGATGATG
>probe:Drosophila_2:1630886_at:1:65; Interrogation_Position=515; Antisense; ATGGGCCACGTCTTCGATGATGGAC
>probe:Drosophila_2:1630886_at:630:579; Interrogation_Position=518; Antisense; GGCCACGTCTTCGATGATGGACCGC
>probe:Drosophila_2:1630886_at:394:307; Interrogation_Position=520; Antisense; CCACGTCTTCGATGATGGACCGCCG
>probe:Drosophila_2:1630886_at:140:301; Interrogation_Position=545; Antisense; CCCAAGCATCGACGCTTCTGCATCA
>probe:Drosophila_2:1630886_at:505:713; Interrogation_Position=560; Antisense; TTCTGCATCAATTCCGCGTCCATCG
>probe:Drosophila_2:1630886_at:45:33; Interrogation_Position=566; Antisense; ATCAATTCCGCGTCCATCGATTTCG
>probe:Drosophila_2:1630886_at:71:247; Interrogation_Position=569; Antisense; AATTCCGCGTCCATCGATTTCGTGA
>probe:Drosophila_2:1630886_at:488:633; Interrogation_Position=572; Antisense; TCCGCGTCCATCGATTTCGTGAAGA
>probe:Drosophila_2:1630886_at:45:329; Interrogation_Position=575; Antisense; GCGTCCATCGATTTCGTGAAGAAAC
>probe:Drosophila_2:1630886_at:385:715; Interrogation_Position=587; Antisense; TTCGTGAAGAAACGTATACGCACTG

Paste this into a BLAST search page for me
ACCGAGGTGCGCTGCTCCCGATGCTGAGGTGCGCTGCTCCCGATGCTCCGGATGCTCCGCCCATATGGGCCACGTCATATGGGCCACGTCTTCGATGATGATGGGCCACGTCTTCGATGATGGACGGCCACGTCTTCGATGATGGACCGCCCACGTCTTCGATGATGGACCGCCGCCCAAGCATCGACGCTTCTGCATCATTCTGCATCAATTCCGCGTCCATCGATCAATTCCGCGTCCATCGATTTCGAATTCCGCGTCCATCGATTTCGTGATCCGCGTCCATCGATTTCGTGAAGAGCGTCCATCGATTTCGTGAAGAAACTTCGTGAAGAAACGTATACGCACTG

Full Affymetrix probeset data:

Annotations for 1630886_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime