FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630889_at:

>probe:Drosophila_2:1630889_at:422:591; Interrogation_Position=167; Antisense; TGGTGCCTGACCAGAGGTCCAAGTT
>probe:Drosophila_2:1630889_at:179:217; Interrogation_Position=187; Antisense; AAGTTCGATAGCGACGAGCTCTTCC
>probe:Drosophila_2:1630889_at:320:117; Interrogation_Position=203; Antisense; AGCTCTTCCGCCGATTGAGTAGGGA
>probe:Drosophila_2:1630889_at:145:539; Interrogation_Position=234; Antisense; GGTTCGCTACACAGGATACCGGGAA
>probe:Drosophila_2:1630889_at:241:539; Interrogation_Position=284; Antisense; GGTTTGTCAACGACTGCCGCAAGGG
>probe:Drosophila_2:1630889_at:35:459; Interrogation_Position=318; Antisense; GATATCGATGGTAGCTTCAGGAACT
>probe:Drosophila_2:1630889_at:221:73; Interrogation_Position=336; Antisense; AGGAACTAATCTGCAGCTCTACTTC
>probe:Drosophila_2:1630889_at:521:235; Interrogation_Position=373; Antisense; AATCCGTACGCCCAGGAGCAGGATT
>probe:Drosophila_2:1630889_at:671:471; Interrogation_Position=424; Antisense; GTTCATTTGCGTTCTAGTTTCATCA
>probe:Drosophila_2:1630889_at:330:41; Interrogation_Position=485; Antisense; ATCTGGACCGACTGGATGGCGCTGC
>probe:Drosophila_2:1630889_at:698:625; Interrogation_Position=507; Antisense; TGCCTGCCTGGAGTTCGATGAACAA
>probe:Drosophila_2:1630889_at:257:463; Interrogation_Position=567; Antisense; GATTCAAAGCTACAACCAGCGCATG
>probe:Drosophila_2:1630889_at:543:431; Interrogation_Position=595; Antisense; GAGTCCAGGAGAATCTACCACACGC
>probe:Drosophila_2:1630889_at:134:651; Interrogation_Position=639; Antisense; TCACCATCACAGAGGTGGGCCTGGT

Paste this into a BLAST search page for me
TGGTGCCTGACCAGAGGTCCAAGTTAAGTTCGATAGCGACGAGCTCTTCCAGCTCTTCCGCCGATTGAGTAGGGAGGTTCGCTACACAGGATACCGGGAAGGTTTGTCAACGACTGCCGCAAGGGGATATCGATGGTAGCTTCAGGAACTAGGAACTAATCTGCAGCTCTACTTCAATCCGTACGCCCAGGAGCAGGATTGTTCATTTGCGTTCTAGTTTCATCAATCTGGACCGACTGGATGGCGCTGCTGCCTGCCTGGAGTTCGATGAACAAGATTCAAAGCTACAACCAGCGCATGGAGTCCAGGAGAATCTACCACACGCTCACCATCACAGAGGTGGGCCTGGT

Full Affymetrix probeset data:

Annotations for 1630889_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720