FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630890_at:

>probe:Drosophila_2:1630890_at:147:373; Interrogation_Position=423; Antisense; GAAGTCCGCATCCAACATAGCCGAT
>probe:Drosophila_2:1630890_at:338:339; Interrogation_Position=452; Antisense; GCTACGCCCAATGGAAGTGCAGTTT
>probe:Drosophila_2:1630890_at:523:91; Interrogation_Position=472; Antisense; AGTTTCGAGCATCTGGCCCAAAAGC
>probe:Drosophila_2:1630890_at:440:499; Interrogation_Position=503; Antisense; GTCTCCATGACATCAGCGAGGCCAT
>probe:Drosophila_2:1630890_at:402:123; Interrogation_Position=517; Antisense; AGCGAGGCCATGACCGGACAGACCA
>probe:Drosophila_2:1630890_at:689:259; Interrogation_Position=564; Antisense; CACGGATCCCAAGAGGTGTCTGATG
>probe:Drosophila_2:1630890_at:257:53; Interrogation_Position=586; Antisense; ATGGTTATGGACTCCAGTTCGCCGG
>probe:Drosophila_2:1630890_at:435:431; Interrogation_Position=610; Antisense; GAGTCACCGCTCTACGACATGGTCG
>probe:Drosophila_2:1630890_at:679:553; Interrogation_Position=726; Antisense; GGACGCCCAGTTTCAGCGGGATCTG
>probe:Drosophila_2:1630890_at:630:451; Interrogation_Position=745; Antisense; GATCTGCGCGATCTGGAGGATTACT
>probe:Drosophila_2:1630890_at:476:73; Interrogation_Position=761; Antisense; AGGATTACTACGGTGGATTCCACTT
>probe:Drosophila_2:1630890_at:96:191; Interrogation_Position=837; Antisense; AACATAGAGCCATTTGTATAGCCAA
>probe:Drosophila_2:1630890_at:539:689; Interrogation_Position=862; Antisense; TATTGTGATAGCTCGTAAGCCCAAA
>probe:Drosophila_2:1630890_at:18:91; Interrogation_Position=931; Antisense; AGTAGCCCACTTTATTATTTATTCG

Paste this into a BLAST search page for me
GAAGTCCGCATCCAACATAGCCGATGCTACGCCCAATGGAAGTGCAGTTTAGTTTCGAGCATCTGGCCCAAAAGCGTCTCCATGACATCAGCGAGGCCATAGCGAGGCCATGACCGGACAGACCACACGGATCCCAAGAGGTGTCTGATGATGGTTATGGACTCCAGTTCGCCGGGAGTCACCGCTCTACGACATGGTCGGGACGCCCAGTTTCAGCGGGATCTGGATCTGCGCGATCTGGAGGATTACTAGGATTACTACGGTGGATTCCACTTAACATAGAGCCATTTGTATAGCCAATATTGTGATAGCTCGTAAGCCCAAAAGTAGCCCACTTTATTATTTATTCG

Full Affymetrix probeset data:

Annotations for 1630890_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720