FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630892_at:

>probe:Drosophila_2:1630892_at:29:315; Interrogation_Position=1501; Antisense; GCCTTTGGATTCTCGGGCATGGAAA
>probe:Drosophila_2:1630892_at:493:159; Interrogation_Position=1574; Antisense; ACAACAATGGCATCTATGGCGGCTT
>probe:Drosophila_2:1630892_at:261:69; Interrogation_Position=1589; Antisense; ATGGCGGCTTCGACAAGGACACTTT
>probe:Drosophila_2:1630892_at:562:73; Interrogation_Position=1604; Antisense; AGGACACTTTTGAGGCCATTCGCAG
>probe:Drosophila_2:1630892_at:436:347; Interrogation_Position=1625; Antisense; GCAGTGAGGGCGATCTTACCCAAAT
>probe:Drosophila_2:1630892_at:260:165; Interrogation_Position=1646; Antisense; AAATCACACCACCATCGGCATTGGG
>probe:Drosophila_2:1630892_at:486:273; Interrogation_Position=1664; Antisense; CATTGGGAGTTCAGGTGCGCTACGA
>probe:Drosophila_2:1630892_at:74:209; Interrogation_Position=1701; Antisense; AATGTTCGGCATGAAGGGCTACTTC
>probe:Drosophila_2:1630892_at:249:525; Interrogation_Position=1716; Antisense; GGGCTACTTCTGCACAGAGATCGAA
>probe:Drosophila_2:1630892_at:497:13; Interrogation_Position=1795; Antisense; ATTAATGTGGCCATCAGCCCGTCAT
>probe:Drosophila_2:1630892_at:471:87; Interrogation_Position=1835; Antisense; AGTCCTTCAACTGGCTCACAGAGTC
>probe:Drosophila_2:1630892_at:453:709; Interrogation_Position=1891; Antisense; TTAAGCACGATGTTCACCATTCCGA
>probe:Drosophila_2:1630892_at:271:693; Interrogation_Position=1957; Antisense; TTTGATACGCCCTCATTATTGTTGG
>probe:Drosophila_2:1630892_at:201:341; Interrogation_Position=1981; Antisense; GCTACTCATTAATTGTTGGCTCGCT

Paste this into a BLAST search page for me
GCCTTTGGATTCTCGGGCATGGAAAACAACAATGGCATCTATGGCGGCTTATGGCGGCTTCGACAAGGACACTTTAGGACACTTTTGAGGCCATTCGCAGGCAGTGAGGGCGATCTTACCCAAATAAATCACACCACCATCGGCATTGGGCATTGGGAGTTCAGGTGCGCTACGAAATGTTCGGCATGAAGGGCTACTTCGGGCTACTTCTGCACAGAGATCGAAATTAATGTGGCCATCAGCCCGTCATAGTCCTTCAACTGGCTCACAGAGTCTTAAGCACGATGTTCACCATTCCGATTTGATACGCCCTCATTATTGTTGGGCTACTCATTAATTGTTGGCTCGCT

Full Affymetrix probeset data:

Annotations for 1630892_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720