FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630893_at:

>probe:Drosophila_2:1630893_at:300:133; Interrogation_Position=1331; Antisense; ACGCCAATTGGAGCACAGTCTTTCT
>probe:Drosophila_2:1630893_at:285:155; Interrogation_Position=1345; Antisense; ACAGTCTTTCTGGTGCACGGGCGCT
>probe:Drosophila_2:1630893_at:200:549; Interrogation_Position=1397; Antisense; GGAGTCTTCAAAAACCTGGCCAGCC
>probe:Drosophila_2:1630893_at:618:579; Interrogation_Position=1414; Antisense; GGCCAGCCACTTTAGAATGCATTTC
>probe:Drosophila_2:1630893_at:114:273; Interrogation_Position=1491; Antisense; CATTTGGAATGGGTCTGGCGGTTAA
>probe:Drosophila_2:1630893_at:251:383; Interrogation_Position=1538; Antisense; GAACTCAACTATTGTGTGCCAGTGC
>probe:Drosophila_2:1630893_at:36:507; Interrogation_Position=1553; Antisense; GTGCCAGTGCGTCATCAGGATACAG
>probe:Drosophila_2:1630893_at:259:63; Interrogation_Position=1590; Antisense; ATGGTTTCCAGTTTGGCATTGGCTA
>probe:Drosophila_2:1630893_at:47:613; Interrogation_Position=1615; Antisense; TGAATTCGTTTAGATGCCCTTTTCC
>probe:Drosophila_2:1630893_at:44:57; Interrogation_Position=1677; Antisense; ATGAGAGTCACAACAGCCCAGTTAG
>probe:Drosophila_2:1630893_at:647:703; Interrogation_Position=1712; Antisense; TTATTCACAACATATGGCTGCCCTG
>probe:Drosophila_2:1630893_at:200:67; Interrogation_Position=1725; Antisense; ATGGCTGCCCTGTTCGTAGTTTCGA
>probe:Drosophila_2:1630893_at:395:479; Interrogation_Position=1743; Antisense; GTTTCGAGCGTTTACAGATTCTGTT
>probe:Drosophila_2:1630893_at:509:481; Interrogation_Position=1807; Antisense; GTATTCGTAGTCCAGCGATCATTTA

Paste this into a BLAST search page for me
ACGCCAATTGGAGCACAGTCTTTCTACAGTCTTTCTGGTGCACGGGCGCTGGAGTCTTCAAAAACCTGGCCAGCCGGCCAGCCACTTTAGAATGCATTTCCATTTGGAATGGGTCTGGCGGTTAAGAACTCAACTATTGTGTGCCAGTGCGTGCCAGTGCGTCATCAGGATACAGATGGTTTCCAGTTTGGCATTGGCTATGAATTCGTTTAGATGCCCTTTTCCATGAGAGTCACAACAGCCCAGTTAGTTATTCACAACATATGGCTGCCCTGATGGCTGCCCTGTTCGTAGTTTCGAGTTTCGAGCGTTTACAGATTCTGTTGTATTCGTAGTCCAGCGATCATTTA

Full Affymetrix probeset data:

Annotations for 1630893_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720