FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630895_at:

>probe:Drosophila_2:1630895_at:438:155; Interrogation_Position=2948; Antisense; ACACGGATGCCGGACAGTTTTGAAT
>probe:Drosophila_2:1630895_at:531:163; Interrogation_Position=2989; Antisense; AAATACTAGACTCTGGCCGGTGACC
>probe:Drosophila_2:1630895_at:186:7; Interrogation_Position=3064; Antisense; ATTGAATAGGCCGTCCCAGGGATCG
>probe:Drosophila_2:1630895_at:282:459; Interrogation_Position=3103; Antisense; GATTTCCAAGGAGTATATTCAGCAT
>probe:Drosophila_2:1630895_at:154:13; Interrogation_Position=3119; Antisense; ATTCAGCATTATCTTTGGCAAACAT
>probe:Drosophila_2:1630895_at:271:189; Interrogation_Position=3139; Antisense; AACATAGCACCCACATATTCGGAGT
>probe:Drosophila_2:1630895_at:219:717; Interrogation_Position=3156; Antisense; TTCGGAGTCCGATGTGGTATGTGCC
>probe:Drosophila_2:1630895_at:542:539; Interrogation_Position=3171; Antisense; GGTATGTGCCACATCGCAAACATTT
>probe:Drosophila_2:1630895_at:350:561; Interrogation_Position=3211; Antisense; GGAACTCTATTTTATGTGCTCTTAT
>probe:Drosophila_2:1630895_at:646:507; Interrogation_Position=3226; Antisense; GTGCTCTTATCTCACGAACAAGCTC
>probe:Drosophila_2:1630895_at:310:387; Interrogation_Position=3241; Antisense; GAACAAGCTCGAAACATGCGGGAAA
>probe:Drosophila_2:1630895_at:477:711; Interrogation_Position=3385; Antisense; TTCAGCGGACTGAATCGCGAACTGT
>probe:Drosophila_2:1630895_at:11:193; Interrogation_Position=3414; Antisense; AACTCTATTGCGAAATCGTTCAGCA
>probe:Drosophila_2:1630895_at:100:569; Interrogation_Position=3475; Antisense; GGCAGAATCCAACCAGAGACGTATT

Paste this into a BLAST search page for me
ACACGGATGCCGGACAGTTTTGAATAAATACTAGACTCTGGCCGGTGACCATTGAATAGGCCGTCCCAGGGATCGGATTTCCAAGGAGTATATTCAGCATATTCAGCATTATCTTTGGCAAACATAACATAGCACCCACATATTCGGAGTTTCGGAGTCCGATGTGGTATGTGCCGGTATGTGCCACATCGCAAACATTTGGAACTCTATTTTATGTGCTCTTATGTGCTCTTATCTCACGAACAAGCTCGAACAAGCTCGAAACATGCGGGAAATTCAGCGGACTGAATCGCGAACTGTAACTCTATTGCGAAATCGTTCAGCAGGCAGAATCCAACCAGAGACGTATT

Full Affymetrix probeset data:

Annotations for 1630895_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720