FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630896_at:

>probe:Drosophila_2:1630896_at:93:183; Interrogation_Position=1177; Antisense; AAAAGAATCGCTTCAAGTCCTTGAT
>probe:Drosophila_2:1630896_at:472:87; Interrogation_Position=1192; Antisense; AGTCCTTGATTCTTCGCCAGGCGGA
>probe:Drosophila_2:1630896_at:423:81; Interrogation_Position=1258; Antisense; AGGGTCTCATCGCTACCATGATGAA
>probe:Drosophila_2:1630896_at:39:437; Interrogation_Position=1277; Antisense; GATGAACGATCTCAACAACGCCGTC
>probe:Drosophila_2:1630896_at:189:201; Interrogation_Position=1293; Antisense; AACGCCGTCGAGATCTCGAACGATT
>probe:Drosophila_2:1630896_at:662:421; Interrogation_Position=1329; Antisense; GAGAAGGCATTGCACCTGGACTCCA
>probe:Drosophila_2:1630896_at:95:397; Interrogation_Position=1386; Antisense; GACAATACAGAGATGCGCTTTCAAA
>probe:Drosophila_2:1630896_at:683:189; Interrogation_Position=1476; Antisense; AACATAATACCCAATAATCCGCCAC
>probe:Drosophila_2:1630896_at:274:239; Interrogation_Position=1488; Antisense; AATAATCCGCCACGAATTTTCCATT
>probe:Drosophila_2:1630896_at:362:307; Interrogation_Position=1508; Antisense; CCATTCGGTGGCCTCTTTAATTGGA
>probe:Drosophila_2:1630896_at:626:165; Interrogation_Position=1577; Antisense; AAATCGACTTTTCAACTCGCGCAAG
>probe:Drosophila_2:1630896_at:252:313; Interrogation_Position=1595; Antisense; GCGCAAGAACTGTATTTTCCCGTGG
>probe:Drosophila_2:1630896_at:558:165; Interrogation_Position=1671; Antisense; AAAGTCCATAATGTTCTCCGCCTTT
>probe:Drosophila_2:1630896_at:196:299; Interrogation_Position=1689; Antisense; CGCCTTTTCAATTTCAGCACTGTGT

Paste this into a BLAST search page for me
AAAAGAATCGCTTCAAGTCCTTGATAGTCCTTGATTCTTCGCCAGGCGGAAGGGTCTCATCGCTACCATGATGAAGATGAACGATCTCAACAACGCCGTCAACGCCGTCGAGATCTCGAACGATTGAGAAGGCATTGCACCTGGACTCCAGACAATACAGAGATGCGCTTTCAAAAACATAATACCCAATAATCCGCCACAATAATCCGCCACGAATTTTCCATTCCATTCGGTGGCCTCTTTAATTGGAAAATCGACTTTTCAACTCGCGCAAGGCGCAAGAACTGTATTTTCCCGTGGAAAGTCCATAATGTTCTCCGCCTTTCGCCTTTTCAATTTCAGCACTGTGT

Full Affymetrix probeset data:

Annotations for 1630896_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720