FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630897_at:

>probe:Drosophila_2:1630897_at:341:511; Interrogation_Position=3456; Antisense; GTGAATTCTACATAGCAACAACAGA
>probe:Drosophila_2:1630897_at:209:647; Interrogation_Position=3488; Antisense; TCAGTTCCAGAACCACAATAACCAA
>probe:Drosophila_2:1630897_at:60:381; Interrogation_Position=3497; Antisense; GAACCACAATAACCAACTAACAGAT
>probe:Drosophila_2:1630897_at:248:191; Interrogation_Position=3564; Antisense; AACTTTAGCCTGTTTTATTCACATG
>probe:Drosophila_2:1630897_at:82:315; Interrogation_Position=3571; Antisense; GCCTGTTTTATTCACATGTTTTCTT
>probe:Drosophila_2:1630897_at:515:711; Interrogation_Position=3603; Antisense; TTCTTTGATTTTGGAAATGCCTTTC
>probe:Drosophila_2:1630897_at:38:561; Interrogation_Position=3615; Antisense; GGAAATGCCTTTCGTTTGCTATCAT
>probe:Drosophila_2:1630897_at:373:315; Interrogation_Position=3621; Antisense; GCCTTTCGTTTGCTATCATTTATAA
>probe:Drosophila_2:1630897_at:447:21; Interrogation_Position=3704; Antisense; ATATATAGACACTACACAAGGCACC
>probe:Drosophila_2:1630897_at:309:567; Interrogation_Position=3723; Antisense; GGCACCCTGCATAATAATTGTTGTC
>probe:Drosophila_2:1630897_at:191:465; Interrogation_Position=3742; Antisense; GTTGTCATTAAACAAGCGTCATAAG
>probe:Drosophila_2:1630897_at:224:293; Interrogation_Position=3758; Antisense; CGTCATAAGTACGATCAGAACATAT
>probe:Drosophila_2:1630897_at:217:647; Interrogation_Position=3818; Antisense; TCATGTTGTAAAAGTTGTGCCAAGC
>probe:Drosophila_2:1630897_at:167:727; Interrogation_Position=3832; Antisense; TTGTGCCAAGCAAAGACGAAACCAA

Paste this into a BLAST search page for me
GTGAATTCTACATAGCAACAACAGATCAGTTCCAGAACCACAATAACCAAGAACCACAATAACCAACTAACAGATAACTTTAGCCTGTTTTATTCACATGGCCTGTTTTATTCACATGTTTTCTTTTCTTTGATTTTGGAAATGCCTTTCGGAAATGCCTTTCGTTTGCTATCATGCCTTTCGTTTGCTATCATTTATAAATATATAGACACTACACAAGGCACCGGCACCCTGCATAATAATTGTTGTCGTTGTCATTAAACAAGCGTCATAAGCGTCATAAGTACGATCAGAACATATTCATGTTGTAAAAGTTGTGCCAAGCTTGTGCCAAGCAAAGACGAAACCAA

Full Affymetrix probeset data:

Annotations for 1630897_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720