Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630899_at:

>probe:Drosophila_2:1630899_at:192:623; Interrogation_Position=106; Antisense; TGCGAGATCTACAAATTGCCCGACT
>probe:Drosophila_2:1630899_at:292:301; Interrogation_Position=124; Antisense; CCCGACTGGGTGGTATGTTGGCTCT
>probe:Drosophila_2:1630899_at:316:727; Interrogation_Position=141; Antisense; TTGGCTCTGATTGGATATGGTCGCA
>probe:Drosophila_2:1630899_at:297:681; Interrogation_Position=188; Antisense; TATGGATTCCGGCTAGGTCTTCGCT
>probe:Drosophila_2:1630899_at:470:623; Interrogation_Position=236; Antisense; TCCTGGTACCGCAAGGGTGACCGAT
>probe:Drosophila_2:1630899_at:580:457; Interrogation_Position=258; Antisense; GATATCCGGGCAGTAAGCTCTACGC
>probe:Drosophila_2:1630899_at:318:421; Interrogation_Position=379; Antisense; GAGCAGCGACGATTTCAGCGGAAGT
>probe:Drosophila_2:1630899_at:4:63; Interrogation_Position=413; Antisense; ATGTCGGATCCTGGAGCTGCGGCCA
>probe:Drosophila_2:1630899_at:141:333; Interrogation_Position=431; Antisense; GCGGCCAGTATTTTCAGCAGCGGCA
>probe:Drosophila_2:1630899_at:604:267; Interrogation_Position=454; Antisense; CAGTGGCATGTGAGTCTCGCAGGAC
>probe:Drosophila_2:1630899_at:516:635; Interrogation_Position=479; Antisense; TCGCTGGCGTGGCAAAGTCCTGAAA
>probe:Drosophila_2:1630899_at:50:677; Interrogation_Position=540; Antisense; TAGTCAAGCCTTGCTAGTCCTGGCA
>probe:Drosophila_2:1630899_at:386:339; Interrogation_Position=552; Antisense; GCTAGTCCTGGCATCTAACACATAT
>probe:Drosophila_2:1630899_at:465:7; Interrogation_Position=624; Antisense; ATTGCTCTAAGTTCGCTAATATCTA

Paste this into a BLAST search page for me
TGCGAGATCTACAAATTGCCCGACTCCCGACTGGGTGGTATGTTGGCTCTTTGGCTCTGATTGGATATGGTCGCATATGGATTCCGGCTAGGTCTTCGCTTCCTGGTACCGCAAGGGTGACCGATGATATCCGGGCAGTAAGCTCTACGCGAGCAGCGACGATTTCAGCGGAAGTATGTCGGATCCTGGAGCTGCGGCCAGCGGCCAGTATTTTCAGCAGCGGCACAGTGGCATGTGAGTCTCGCAGGACTCGCTGGCGTGGCAAAGTCCTGAAATAGTCAAGCCTTGCTAGTCCTGGCAGCTAGTCCTGGCATCTAACACATATATTGCTCTAAGTTCGCTAATATCTA

Full Affymetrix probeset data:

Annotations for 1630899_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime