Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630900_at:

>probe:Drosophila_2:1630900_at:501:427; Interrogation_Position=1982; Antisense; GAGATAGGACTAGCGGCCAGCACAA
>probe:Drosophila_2:1630900_at:563:331; Interrogation_Position=1994; Antisense; GCGGCCAGCACAAGTCAAATTCATT
>probe:Drosophila_2:1630900_at:590:245; Interrogation_Position=2011; Antisense; AATTCATTTGACACGGTCGTAGGGA
>probe:Drosophila_2:1630900_at:716:527; Interrogation_Position=2054; Antisense; GGGAGCTCTGTATCCGTTTCGGACT
>probe:Drosophila_2:1630900_at:295:629; Interrogation_Position=2066; Antisense; TCCGTTTCGGACTGTGTTGGATAAC
>probe:Drosophila_2:1630900_at:515:525; Interrogation_Position=2104; Antisense; GGGAACGATCGTATGTAATGCTTAA
>probe:Drosophila_2:1630900_at:246:491; Interrogation_Position=2118; Antisense; GTAATGCTTAAGTTCCTCTAGTTAA
>probe:Drosophila_2:1630900_at:590:25; Interrogation_Position=2165; Antisense; ATAGCGCGGTGATGGTTGTTATCTT
>probe:Drosophila_2:1630900_at:252:11; Interrogation_Position=2241; Antisense; ATTCATTCGTATCACTGTAGCTCCT
>probe:Drosophila_2:1630900_at:408:487; Interrogation_Position=2257; Antisense; GTAGCTCCTTTATTAATCCGCTTAA
>probe:Drosophila_2:1630900_at:636:705; Interrogation_Position=2289; Antisense; TTACATTGCACACGACAGATGGTCT
>probe:Drosophila_2:1630900_at:599:493; Interrogation_Position=2333; Antisense; GTCACAAAAGCACACTACGTCAGTA
>probe:Drosophila_2:1630900_at:263:181; Interrogation_Position=2455; Antisense; AAAAATATGGTCATGCCCTGCTTTT
>probe:Drosophila_2:1630900_at:141:271; Interrogation_Position=2466; Antisense; CATGCCCTGCTTTTTGAAATTCTAA

Paste this into a BLAST search page for me
GAGATAGGACTAGCGGCCAGCACAAGCGGCCAGCACAAGTCAAATTCATTAATTCATTTGACACGGTCGTAGGGAGGGAGCTCTGTATCCGTTTCGGACTTCCGTTTCGGACTGTGTTGGATAACGGGAACGATCGTATGTAATGCTTAAGTAATGCTTAAGTTCCTCTAGTTAAATAGCGCGGTGATGGTTGTTATCTTATTCATTCGTATCACTGTAGCTCCTGTAGCTCCTTTATTAATCCGCTTAATTACATTGCACACGACAGATGGTCTGTCACAAAAGCACACTACGTCAGTAAAAAATATGGTCATGCCCTGCTTTTCATGCCCTGCTTTTTGAAATTCTAA

Full Affymetrix probeset data:

Annotations for 1630900_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime