Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630906_at:

>probe:Drosophila_2:1630906_at:415:357; Interrogation_Position=2835; Antisense; GCAACAGGAGCTGCTACTTCAACAG
>probe:Drosophila_2:1630906_at:279:559; Interrogation_Position=2922; Antisense; GGACACATCACACTATCAGCAACAG
>probe:Drosophila_2:1630906_at:238:105; Interrogation_Position=2957; Antisense; AGACGACACCAAAGCTGCTGCATCC
>probe:Drosophila_2:1630906_at:270:283; Interrogation_Position=3013; Antisense; CTGCGCGACAAGGAGATCACACGTG
>probe:Drosophila_2:1630906_at:662:257; Interrogation_Position=3030; Antisense; CACACGTGAAATACTCGAGCTGATT
>probe:Drosophila_2:1630906_at:23:437; Interrogation_Position=3058; Antisense; GAGGATAGCAACATTCAGTACTGGA
>probe:Drosophila_2:1630906_at:707:89; Interrogation_Position=3074; Antisense; AGTACTGGAAGGTATCGGCCCGCCT
>probe:Drosophila_2:1630906_at:465:303; Interrogation_Position=3093; Antisense; CCGCCTGGCTGAGAAGGGCATCAAT
>probe:Drosophila_2:1630906_at:163:293; Interrogation_Position=3132; Antisense; CGTCTGCCAGAAGCTCAAGTCGATG
>probe:Drosophila_2:1630906_at:496:219; Interrogation_Position=3148; Antisense; AAGTCGATGGGTATCCACAGGCGCT
>probe:Drosophila_2:1630906_at:650:153; Interrogation_Position=3164; Antisense; ACAGGCGCTGGAAGCCAGGCGACAA
>probe:Drosophila_2:1630906_at:123:623; Interrogation_Position=3197; Antisense; TGCTGGCCATCAGTCAGCTGAAAGC
>probe:Drosophila_2:1630906_at:675:581; Interrogation_Position=3300; Antisense; TGGCAGTAGTTTTGGCCTGGCCGAC
>probe:Drosophila_2:1630906_at:682:581; Interrogation_Position=3317; Antisense; TGGCCGACGATAGCTTCGAGCAGCA

Paste this into a BLAST search page for me
GCAACAGGAGCTGCTACTTCAACAGGGACACATCACACTATCAGCAACAGAGACGACACCAAAGCTGCTGCATCCCTGCGCGACAAGGAGATCACACGTGCACACGTGAAATACTCGAGCTGATTGAGGATAGCAACATTCAGTACTGGAAGTACTGGAAGGTATCGGCCCGCCTCCGCCTGGCTGAGAAGGGCATCAATCGTCTGCCAGAAGCTCAAGTCGATGAAGTCGATGGGTATCCACAGGCGCTACAGGCGCTGGAAGCCAGGCGACAATGCTGGCCATCAGTCAGCTGAAAGCTGGCAGTAGTTTTGGCCTGGCCGACTGGCCGACGATAGCTTCGAGCAGCA

Full Affymetrix probeset data:

Annotations for 1630906_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime