FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630908_at:

>probe:Drosophila_2:1630908_at:7:697; Interrogation_Position=1640; Antisense; TTACTCGCAAGGATGCCCGGAAGAT
>probe:Drosophila_2:1630908_at:4:217; Interrogation_Position=1675; Antisense; AAGTTGATGTCTCACGGCTTCGATA
>probe:Drosophila_2:1630908_at:414:511; Interrogation_Position=1738; Antisense; GTGAACTCCGAGCTGACAGAGCACC
>probe:Drosophila_2:1630908_at:602:193; Interrogation_Position=1775; Antisense; AACTGCAACATCCACATTTTTACGC
>probe:Drosophila_2:1630908_at:337:145; Interrogation_Position=1801; Antisense; ACTCGAAATCGCATCCGCAAGTTTG
>probe:Drosophila_2:1630908_at:131:691; Interrogation_Position=1822; Antisense; TTTGTCGAAAAACTGTGCTCCGCCA
>probe:Drosophila_2:1630908_at:635:215; Interrogation_Position=1846; Antisense; AAGTTCTCGGAACGCGCGGAAATGT
>probe:Drosophila_2:1630908_at:623:469; Interrogation_Position=1869; Antisense; GTTGCTGAAGCACAAGAGTCCACTC
>probe:Drosophila_2:1630908_at:645:79; Interrogation_Position=1927; Antisense; AGGTCTGCGATCTCTGAAAAGTCTG
>probe:Drosophila_2:1630908_at:655:543; Interrogation_Position=1956; Antisense; GGATATAGCCAGCTCTCAAGGCGAA
>probe:Drosophila_2:1630908_at:334:475; Interrogation_Position=2047; Antisense; GTTAGTCGCGATTTCAAGGCTCGTC
>probe:Drosophila_2:1630908_at:542:203; Interrogation_Position=2089; Antisense; AAGCCGGCGGCCACTATTCGAGGAG
>probe:Drosophila_2:1630908_at:36:689; Interrogation_Position=2103; Antisense; TATTCGAGGAGCTTCCAAGTCGTCC
>probe:Drosophila_2:1630908_at:416:607; Interrogation_Position=2165; Antisense; TGATGTTCAACACCACGGAGGACGG

Paste this into a BLAST search page for me
TTACTCGCAAGGATGCCCGGAAGATAAGTTGATGTCTCACGGCTTCGATAGTGAACTCCGAGCTGACAGAGCACCAACTGCAACATCCACATTTTTACGCACTCGAAATCGCATCCGCAAGTTTGTTTGTCGAAAAACTGTGCTCCGCCAAAGTTCTCGGAACGCGCGGAAATGTGTTGCTGAAGCACAAGAGTCCACTCAGGTCTGCGATCTCTGAAAAGTCTGGGATATAGCCAGCTCTCAAGGCGAAGTTAGTCGCGATTTCAAGGCTCGTCAAGCCGGCGGCCACTATTCGAGGAGTATTCGAGGAGCTTCCAAGTCGTCCTGATGTTCAACACCACGGAGGACGG

Full Affymetrix probeset data:

Annotations for 1630908_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720