FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630912_at:

>probe:Drosophila_2:1630912_at:70:469; Interrogation_Position=461; Antisense; GTTGAACACGTGACCGTCCTGATCG
>probe:Drosophila_2:1630912_at:656:269; Interrogation_Position=487; Antisense; CATAGCCGTGAAGGATGCTGCTGTG
>probe:Drosophila_2:1630912_at:17:519; Interrogation_Position=509; Antisense; GTGGGCGGCATCATTCATCAGCCAT
>probe:Drosophila_2:1630912_at:61:13; Interrogation_Position=532; Antisense; ATTCTACCAACAGCCCGATGGCGAA
>probe:Drosophila_2:1630912_at:719:293; Interrogation_Position=547; Antisense; CGATGGCGAAATGGGTCGCACCATT
>probe:Drosophila_2:1630912_at:457:9; Interrogation_Position=657; Antisense; ATTCCAATGCCCTGCATCAGCAAGC
>probe:Drosophila_2:1630912_at:351:345; Interrogation_Position=689; Antisense; GCATTCGCATCCACAGAAGTTCTGA
>probe:Drosophila_2:1630912_at:528:107; Interrogation_Position=703; Antisense; AGAAGTTCTGAAAGTCGGAGGCGCT
>probe:Drosophila_2:1630912_at:510:439; Interrogation_Position=720; Antisense; GAGGCGCTGGGTTCAAAGTGCTCCA
>probe:Drosophila_2:1630912_at:384:359; Interrogation_Position=792; Antisense; GCAAGAAGTGGGACACCTGCGCACC
>probe:Drosophila_2:1630912_at:536:419; Interrogation_Position=866; Antisense; GAGCACTACGCCTACAATGCGGATG
>probe:Drosophila_2:1630912_at:350:237; Interrogation_Position=902; Antisense; AATCGACAGGGAGTGCTGGCCAGCC
>probe:Drosophila_2:1630912_at:417:49; Interrogation_Position=939; Antisense; ATGCCGCGCTGGTGGAAAAGATTCC
>probe:Drosophila_2:1630912_at:323:457; Interrogation_Position=998; Antisense; GATAGCTTTGAATTCCAGCACTTTA

Paste this into a BLAST search page for me
GTTGAACACGTGACCGTCCTGATCGCATAGCCGTGAAGGATGCTGCTGTGGTGGGCGGCATCATTCATCAGCCATATTCTACCAACAGCCCGATGGCGAACGATGGCGAAATGGGTCGCACCATTATTCCAATGCCCTGCATCAGCAAGCGCATTCGCATCCACAGAAGTTCTGAAGAAGTTCTGAAAGTCGGAGGCGCTGAGGCGCTGGGTTCAAAGTGCTCCAGCAAGAAGTGGGACACCTGCGCACCGAGCACTACGCCTACAATGCGGATGAATCGACAGGGAGTGCTGGCCAGCCATGCCGCGCTGGTGGAAAAGATTCCGATAGCTTTGAATTCCAGCACTTTA

Full Affymetrix probeset data:

Annotations for 1630912_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720