FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630913_at:

>probe:Drosophila_2:1630913_at:437:529; Interrogation_Position=108; Antisense; GGTGGTGTCCGTATCGAAGCTCCTG
>probe:Drosophila_2:1630913_at:651:377; Interrogation_Position=123; Antisense; GAAGCTCCTGCTCAAGGATAGCAAT
>probe:Drosophila_2:1630913_at:587:623; Interrogation_Position=14; Antisense; TGCGCAATCACAAGGAGAACGGAAA
>probe:Drosophila_2:1630913_at:356:661; Interrogation_Position=153; Antisense; TAACAGCCGGAGTAGCAACAGCAAT
>probe:Drosophila_2:1630913_at:133:189; Interrogation_Position=169; Antisense; AACAGCAATGCCAGCTTCAGTTCCG
>probe:Drosophila_2:1630913_at:214:713; Interrogation_Position=184; Antisense; TTCAGTTCCGCATCGGTCGCCGGTT
>probe:Drosophila_2:1630913_at:646:41; Interrogation_Position=195; Antisense; ATCGGTCGCCGGTTCTGTACAGCGC
>probe:Drosophila_2:1630913_at:195:601; Interrogation_Position=210; Antisense; TGTACAGCGCGCAGAATTCCAATCG
>probe:Drosophila_2:1630913_at:310:351; Interrogation_Position=220; Antisense; GCAGAATTCCAATCGCACACGGTCT
>probe:Drosophila_2:1630913_at:223:197; Interrogation_Position=37; Antisense; AACGGCTCCGAAATGGGCGAGTCGA
>probe:Drosophila_2:1630913_at:71:327; Interrogation_Position=53; Antisense; GCGAGTCGACGAAGAGCTTGGCCAA
>probe:Drosophila_2:1630913_at:229:101; Interrogation_Position=65; Antisense; AGAGCTTGGCCAAAATGGAGCCGGA
>probe:Drosophila_2:1630913_at:433:229; Interrogation_Position=78; Antisense; AATGGAGCCGGAGAACAACAATAAG
>probe:Drosophila_2:1630913_at:44:185; Interrogation_Position=94; Antisense; AACAATAAGATTTCGGTGGTGTCCG

Paste this into a BLAST search page for me
GGTGGTGTCCGTATCGAAGCTCCTGGAAGCTCCTGCTCAAGGATAGCAATTGCGCAATCACAAGGAGAACGGAAATAACAGCCGGAGTAGCAACAGCAATAACAGCAATGCCAGCTTCAGTTCCGTTCAGTTCCGCATCGGTCGCCGGTTATCGGTCGCCGGTTCTGTACAGCGCTGTACAGCGCGCAGAATTCCAATCGGCAGAATTCCAATCGCACACGGTCTAACGGCTCCGAAATGGGCGAGTCGAGCGAGTCGACGAAGAGCTTGGCCAAAGAGCTTGGCCAAAATGGAGCCGGAAATGGAGCCGGAGAACAACAATAAGAACAATAAGATTTCGGTGGTGTCCG

Full Affymetrix probeset data:

Annotations for 1630913_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720