Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630914_s_at:

>probe:Drosophila_2:1630914_s_at:329:629; Interrogation_Position=117; Antisense; TCCAACTACAAGTCCAAGCCCAAGC
>probe:Drosophila_2:1630914_s_at:624:55; Interrogation_Position=13; Antisense; ATGACGGCGATGCACGTGAATCACA
>probe:Drosophila_2:1630914_s_at:577:217; Interrogation_Position=144; Antisense; AAGTCACAGTTCGATGGCCACGGCT
>probe:Drosophila_2:1630914_s_at:712:93; Interrogation_Position=151; Antisense; AGTTCGATGGCCACGGCTGGCAGCA
>probe:Drosophila_2:1630914_s_at:380:573; Interrogation_Position=165; Antisense; GGCTGGCAGCAAGTGTCACGGCCAA
>probe:Drosophila_2:1630914_s_at:584:263; Interrogation_Position=171; Antisense; CAGCAAGTGTCACGGCCAACCGGAA
>probe:Drosophila_2:1630914_s_at:463:575; Interrogation_Position=18; Antisense; GGCGATGCACGTGAATCACAAGCTC
>probe:Drosophila_2:1630914_s_at:718:561; Interrogation_Position=198; Antisense; GGAAGCGGACCAGCGGGCCAATTGA
>probe:Drosophila_2:1630914_s_at:266:511; Interrogation_Position=28; Antisense; GTGAATCACAAGCTCAACATGCGCA
>probe:Drosophila_2:1630914_s_at:334:161; Interrogation_Position=35; Antisense; ACAAGCTCAACATGCGCACAACGGC
>probe:Drosophila_2:1630914_s_at:345:189; Interrogation_Position=43; Antisense; AACATGCGCACAACGGCTGTCAAGA
>probe:Drosophila_2:1630914_s_at:12:625; Interrogation_Position=47; Antisense; TGCGCACAACGGCTGTCAAGATGAA
>probe:Drosophila_2:1630914_s_at:132:335; Interrogation_Position=58; Antisense; GCTGTCAAGATGAAGCGGACCCGAC
>probe:Drosophila_2:1630914_s_at:360:97; Interrogation_Position=65; Antisense; AGATGAAGCGGACCCGACATCCGGC

Paste this into a BLAST search page for me
TCCAACTACAAGTCCAAGCCCAAGCATGACGGCGATGCACGTGAATCACAAAGTCACAGTTCGATGGCCACGGCTAGTTCGATGGCCACGGCTGGCAGCAGGCTGGCAGCAAGTGTCACGGCCAACAGCAAGTGTCACGGCCAACCGGAAGGCGATGCACGTGAATCACAAGCTCGGAAGCGGACCAGCGGGCCAATTGAGTGAATCACAAGCTCAACATGCGCAACAAGCTCAACATGCGCACAACGGCAACATGCGCACAACGGCTGTCAAGATGCGCACAACGGCTGTCAAGATGAAGCTGTCAAGATGAAGCGGACCCGACAGATGAAGCGGACCCGACATCCGGC

Full Affymetrix probeset data:

Annotations for 1630914_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime