Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630916_at:

>probe:Drosophila_2:1630916_at:407:105; Interrogation_Position=2135; Antisense; AGAAACACCAATGCGCGTTAAGCGT
>probe:Drosophila_2:1630916_at:91:627; Interrogation_Position=2273; Antisense; TGCCAAGCGGCTGAGATGTTTAAAT
>probe:Drosophila_2:1630916_at:196:709; Interrogation_Position=2353; Antisense; TTAACCATAACACCTACACATTCAC
>probe:Drosophila_2:1630916_at:537:257; Interrogation_Position=2384; Antisense; CACACACGTTTTTATGCGTAGAAAT
>probe:Drosophila_2:1630916_at:581:479; Interrogation_Position=2498; Antisense; GTATTGTGCCTAAGTATAAACCGAA
>probe:Drosophila_2:1630916_at:251:395; Interrogation_Position=2520; Antisense; GAAATGATAAACACTCACCAAGAGA
>probe:Drosophila_2:1630916_at:141:127; Interrogation_Position=2575; Antisense; AGCCATTTATAATCCTTAGCCTAGC
>probe:Drosophila_2:1630916_at:101:655; Interrogation_Position=2611; Antisense; TAAACCCTGCTTATTAGACGTACCG
>probe:Drosophila_2:1630916_at:403:105; Interrogation_Position=2626; Antisense; AGACGTACCGCATATTTATACCATG
>probe:Drosophila_2:1630916_at:726:21; Interrogation_Position=2637; Antisense; ATATTTATACCATGCCATTCCTGCC
>probe:Drosophila_2:1630916_at:506:315; Interrogation_Position=2650; Antisense; GCCATTCCTGCCCAAAAATATTCAC
>probe:Drosophila_2:1630916_at:60:713; Interrogation_Position=2670; Antisense; TTCACAGCCAAACAATTGCACCGTC
>probe:Drosophila_2:1630916_at:445:255; Interrogation_Position=2678; Antisense; CAAACAATTGCACCGTCTATGTCCC
>probe:Drosophila_2:1630916_at:456:643; Interrogation_Position=2693; Antisense; TCTATGTCCCCGTCTCAAAAAAGAA

Paste this into a BLAST search page for me
AGAAACACCAATGCGCGTTAAGCGTTGCCAAGCGGCTGAGATGTTTAAATTTAACCATAACACCTACACATTCACCACACACGTTTTTATGCGTAGAAATGTATTGTGCCTAAGTATAAACCGAAGAAATGATAAACACTCACCAAGAGAAGCCATTTATAATCCTTAGCCTAGCTAAACCCTGCTTATTAGACGTACCGAGACGTACCGCATATTTATACCATGATATTTATACCATGCCATTCCTGCCGCCATTCCTGCCCAAAAATATTCACTTCACAGCCAAACAATTGCACCGTCCAAACAATTGCACCGTCTATGTCCCTCTATGTCCCCGTCTCAAAAAAGAA

Full Affymetrix probeset data:

Annotations for 1630916_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime