FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630917_at:

>probe:Drosophila_2:1630917_at:708:505; Interrogation_Position=1018; Antisense; GTGCCAGCCACTTTTGTCGCGATCA
>probe:Drosophila_2:1630917_at:432:299; Interrogation_Position=1049; Antisense; CGCCGTCCAGATTATCTCCATAAGA
>probe:Drosophila_2:1630917_at:596:203; Interrogation_Position=1105; Antisense; CACGTAAACAAACACCCACTATCTG
>probe:Drosophila_2:1630917_at:576:39; Interrogation_Position=1125; Antisense; ATCTGGAACCCACTTAAGGCCTTGA
>probe:Drosophila_2:1630917_at:571:227; Interrogation_Position=1140; Antisense; AAGGCCTTGATTGTATCTCTATTGG
>probe:Drosophila_2:1630917_at:369:283; Interrogation_Position=1222; Antisense; CTGCAAAACCTTTTAGGCGGATCAT
>probe:Drosophila_2:1630917_at:142:703; Interrogation_Position=1365; Antisense; TTATAGCTTCTTCAACTCAGGCTCC
>probe:Drosophila_2:1630917_at:301:337; Interrogation_Position=1385; Antisense; GCTCCTATTTCTGTTGTCACCAATT
>probe:Drosophila_2:1630917_at:399:147; Interrogation_Position=877; Antisense; ACTATTTGTACTCCCGACGCGGAGG
>probe:Drosophila_2:1630917_at:236:81; Interrogation_Position=899; Antisense; AGGTGGACTGGAAACCCTGCTGGCC
>probe:Drosophila_2:1630917_at:411:559; Interrogation_Position=941; Antisense; GGACACGCTGCACAAGTTCATGACC
>probe:Drosophila_2:1630917_at:675:409; Interrogation_Position=962; Antisense; GACCCAGCTGGGTGACAGTGGCTAC
>probe:Drosophila_2:1630917_at:286:251; Interrogation_Position=986; Antisense; CAAGGTGACTCCATGTGCGAACGTA
>probe:Drosophila_2:1630917_at:468:597; Interrogation_Position=999; Antisense; TGTGCGAACGTATCGGCCTGTGCCA

Paste this into a BLAST search page for me
GTGCCAGCCACTTTTGTCGCGATCACGCCGTCCAGATTATCTCCATAAGACACGTAAACAAACACCCACTATCTGATCTGGAACCCACTTAAGGCCTTGAAAGGCCTTGATTGTATCTCTATTGGCTGCAAAACCTTTTAGGCGGATCATTTATAGCTTCTTCAACTCAGGCTCCGCTCCTATTTCTGTTGTCACCAATTACTATTTGTACTCCCGACGCGGAGGAGGTGGACTGGAAACCCTGCTGGCCGGACACGCTGCACAAGTTCATGACCGACCCAGCTGGGTGACAGTGGCTACCAAGGTGACTCCATGTGCGAACGTATGTGCGAACGTATCGGCCTGTGCCA

Full Affymetrix probeset data:

Annotations for 1630917_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720