FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630918_at:

>probe:Drosophila_2:1630918_at:19:87; Interrogation_Position=1582; Antisense; AGTCCCCATCGCCATAATATCATTC
>probe:Drosophila_2:1630918_at:53:271; Interrogation_Position=1594; Antisense; CATAATATCATTCCCCGAGCCGGAA
>probe:Drosophila_2:1630918_at:692:375; Interrogation_Position=1616; Antisense; GAAGCACGGCATAGACTTTAACTAG
>probe:Drosophila_2:1630918_at:395:383; Interrogation_Position=1663; Antisense; GAACGTAGGTTTAGCGACAACACAT
>probe:Drosophila_2:1630918_at:66:399; Interrogation_Position=1678; Antisense; GACAACACATCACTATTTCCCAGTT
>probe:Drosophila_2:1630918_at:378:17; Interrogation_Position=1692; Antisense; ATTTCCCAGTTATCCTTGAATCCAG
>probe:Drosophila_2:1630918_at:287:367; Interrogation_Position=1709; Antisense; GAATCCAGGACTAGTCCTTGTCCGG
>probe:Drosophila_2:1630918_at:88:717; Interrogation_Position=1726; Antisense; TTGTCCGGTCGATTTTTGTATCCTT
>probe:Drosophila_2:1630918_at:195:37; Interrogation_Position=1776; Antisense; ATCTCACTCAGTTGCCCATTAATCT
>probe:Drosophila_2:1630918_at:646:305; Interrogation_Position=1802; Antisense; CCTGTCTCTGTCATTCTCATATTTT
>probe:Drosophila_2:1630918_at:82:15; Interrogation_Position=2041; Antisense; ATTACATGGCTGAATCACGTCGTGT
>probe:Drosophila_2:1630918_at:601:239; Interrogation_Position=2053; Antisense; AATCACGTCGTGTAATCCGTCGCAG
>probe:Drosophila_2:1630918_at:10:89; Interrogation_Position=2076; Antisense; AGTCCGCCGTCTGTATTACATTAGC
>probe:Drosophila_2:1630918_at:53:269; Interrogation_Position=2094; Antisense; CATTAGCTGATCACCAAACCGGAAT

Paste this into a BLAST search page for me
AGTCCCCATCGCCATAATATCATTCCATAATATCATTCCCCGAGCCGGAAGAAGCACGGCATAGACTTTAACTAGGAACGTAGGTTTAGCGACAACACATGACAACACATCACTATTTCCCAGTTATTTCCCAGTTATCCTTGAATCCAGGAATCCAGGACTAGTCCTTGTCCGGTTGTCCGGTCGATTTTTGTATCCTTATCTCACTCAGTTGCCCATTAATCTCCTGTCTCTGTCATTCTCATATTTTATTACATGGCTGAATCACGTCGTGTAATCACGTCGTGTAATCCGTCGCAGAGTCCGCCGTCTGTATTACATTAGCCATTAGCTGATCACCAAACCGGAAT

Full Affymetrix probeset data:

Annotations for 1630918_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720