Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630919_at:

>probe:Drosophila_2:1630919_at:310:205; Interrogation_Position=1253; Antisense; AAGCCGCCGGTCAGCGAGCATGTGA
>probe:Drosophila_2:1630919_at:336:371; Interrogation_Position=1276; Antisense; GAAGGACATAGTGCGTCGGAACTTT
>probe:Drosophila_2:1630919_at:304:325; Interrogation_Position=1288; Antisense; GCGTCGGAACTTTACGAACGAGATT
>probe:Drosophila_2:1630919_at:699:607; Interrogation_Position=1312; Antisense; TGAGTTCTATCAATTTTGCCGCCAG
>probe:Drosophila_2:1630919_at:318:245; Interrogation_Position=1323; Antisense; AATTTTGCCGCCAGAGACTCCACAA
>probe:Drosophila_2:1630919_at:394:159; Interrogation_Position=1344; Antisense; ACAAACAATATCTGGCTGCCCACTT
>probe:Drosophila_2:1630919_at:635:623; Interrogation_Position=1360; Antisense; TGCCCACTTACCACAGCGGATTATA
>probe:Drosophila_2:1630919_at:62:331; Interrogation_Position=1375; Antisense; GCGGATTATAACAGACTCAGCACAT
>probe:Drosophila_2:1630919_at:283:321; Interrogation_Position=1402; Antisense; GCCCGGCCTGATTGGCAATTGAACT
>probe:Drosophila_2:1630919_at:462:565; Interrogation_Position=1415; Antisense; GGCAATTGAACTGTACTCTTCACAA
>probe:Drosophila_2:1630919_at:189:237; Interrogation_Position=1477; Antisense; AATCGTACTCGAAACCTGTAGTCAG
>probe:Drosophila_2:1630919_at:276:601; Interrogation_Position=1493; Antisense; TGTAGTCAGCTAAGTTCCCCATTAT
>probe:Drosophila_2:1630919_at:281:303; Interrogation_Position=1509; Antisense; CCCCATTATTGTTTTCTCTTGTGTA
>probe:Drosophila_2:1630919_at:310:689; Interrogation_Position=1731; Antisense; TATTGTCTTTCCACTGATTTCACAG

Paste this into a BLAST search page for me
AAGCCGCCGGTCAGCGAGCATGTGAGAAGGACATAGTGCGTCGGAACTTTGCGTCGGAACTTTACGAACGAGATTTGAGTTCTATCAATTTTGCCGCCAGAATTTTGCCGCCAGAGACTCCACAAACAAACAATATCTGGCTGCCCACTTTGCCCACTTACCACAGCGGATTATAGCGGATTATAACAGACTCAGCACATGCCCGGCCTGATTGGCAATTGAACTGGCAATTGAACTGTACTCTTCACAAAATCGTACTCGAAACCTGTAGTCAGTGTAGTCAGCTAAGTTCCCCATTATCCCCATTATTGTTTTCTCTTGTGTATATTGTCTTTCCACTGATTTCACAG

Full Affymetrix probeset data:

Annotations for 1630919_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime