Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630920_at:

>probe:Drosophila_2:1630920_at:316:45; Interrogation_Position=127; Antisense; ATCGCCTACATTCTGTTTCTATATG
>probe:Drosophila_2:1630920_at:369:681; Interrogation_Position=148; Antisense; TATGGACTCGGTGGCATTATCTTCG
>probe:Drosophila_2:1630920_at:668:15; Interrogation_Position=163; Antisense; ATTATCTTCGTTTCGGCTGTACTGG
>probe:Drosophila_2:1630920_at:666:197; Interrogation_Position=228; Antisense; AACGTACGGCTTCTTGCTGTTGGCT
>probe:Drosophila_2:1630920_at:582:655; Interrogation_Position=260; Antisense; TAATCAGCTTGCTAGGCATCTTCCG
>probe:Drosophila_2:1630920_at:533:37; Interrogation_Position=277; Antisense; ATCTTCCGCTTCAAGTTCACTGAGG
>probe:Drosophila_2:1630920_at:673:667; Interrogation_Position=304; Antisense; TACATAGAGAAGTTCGCCGCCGAGG
>probe:Drosophila_2:1630920_at:681:403; Interrogation_Position=424; Antisense; GACTACGTGGCCATCGGTCGTCAAA
>probe:Drosophila_2:1630920_at:676:97; Interrogation_Position=485; Antisense; AGATGCCCCACTATCTAGCTGGTTG
>probe:Drosophila_2:1630920_at:618:541; Interrogation_Position=505; Antisense; GGTTGCGTCCAAAAGTCCAGTGAGA
>probe:Drosophila_2:1630920_at:214:11; Interrogation_Position=589; Antisense; ATTCTAATGATGATTGCCGCCTTTT
>probe:Drosophila_2:1630920_at:309:315; Interrogation_Position=604; Antisense; GCCGCCTTTTACTTGGTCGGAAGAT
>probe:Drosophila_2:1630920_at:27:463; Interrogation_Position=626; Antisense; GATTCAGGAAGCAGCGCGTTCGCTA
>probe:Drosophila_2:1630920_at:591:45; Interrogation_Position=84; Antisense; ATCCCTGATAGCCATTGCAACGTTG

Paste this into a BLAST search page for me
ATCGCCTACATTCTGTTTCTATATGTATGGACTCGGTGGCATTATCTTCGATTATCTTCGTTTCGGCTGTACTGGAACGTACGGCTTCTTGCTGTTGGCTTAATCAGCTTGCTAGGCATCTTCCGATCTTCCGCTTCAAGTTCACTGAGGTACATAGAGAAGTTCGCCGCCGAGGGACTACGTGGCCATCGGTCGTCAAAAGATGCCCCACTATCTAGCTGGTTGGGTTGCGTCCAAAAGTCCAGTGAGAATTCTAATGATGATTGCCGCCTTTTGCCGCCTTTTACTTGGTCGGAAGATGATTCAGGAAGCAGCGCGTTCGCTAATCCCTGATAGCCATTGCAACGTTG

Full Affymetrix probeset data:

Annotations for 1630920_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime