Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630921_at:

>probe:Drosophila_2:1630921_at:543:173; Interrogation_Position=4212; Antisense; AAAGCCCCAGCCAATTATCAACTTG
>probe:Drosophila_2:1630921_at:566:519; Interrogation_Position=4243; Antisense; GTGGATCTGCCAAATGTGGCGCCCA
>probe:Drosophila_2:1630921_at:114:523; Interrogation_Position=4258; Antisense; GTGGCGCCCAACAGCAAGCAAGCGA
>probe:Drosophila_2:1630921_at:360:263; Interrogation_Position=4283; Antisense; CAGTGGAAACGACTCCCGTGGTCGA
>probe:Drosophila_2:1630921_at:637:393; Interrogation_Position=4306; Antisense; GAAATGCCACCGGATGAGCTCCAAT
>probe:Drosophila_2:1630921_at:631:245; Interrogation_Position=4328; Antisense; AATTCGAGAGTCACCAACTGCCGGA
>probe:Drosophila_2:1630921_at:126:431; Interrogation_Position=4384; Antisense; GAGTCAAATGACCTGCTCAGCGGGT
>probe:Drosophila_2:1630921_at:368:201; Interrogation_Position=4440; Antisense; AACGCCAATTTTGGTATCTGCCACC
>probe:Drosophila_2:1630921_at:537:129; Interrogation_Position=4462; Antisense; ACCTCGTCGATGGACTCGGTGCAAA
>probe:Drosophila_2:1630921_at:525:509; Interrogation_Position=4480; Antisense; GTGCAAAGTGTCATCGAGGTCGTCA
>probe:Drosophila_2:1630921_at:472:43; Interrogation_Position=4492; Antisense; ATCGAGGTCGTCAATGGCATGCCCA
>probe:Drosophila_2:1630921_at:549:487; Interrogation_Position=4598; Antisense; GTACGAAGGATGTTCGTCCCGTCCA
>probe:Drosophila_2:1630921_at:719:493; Interrogation_Position=4613; Antisense; GTCCCGTCCAGGAGGTGACAACGTT
>probe:Drosophila_2:1630921_at:570:155; Interrogation_Position=4630; Antisense; ACAACGTTGACGCTCGACAGGGAAC

Paste this into a BLAST search page for me
AAAGCCCCAGCCAATTATCAACTTGGTGGATCTGCCAAATGTGGCGCCCAGTGGCGCCCAACAGCAAGCAAGCGACAGTGGAAACGACTCCCGTGGTCGAGAAATGCCACCGGATGAGCTCCAATAATTCGAGAGTCACCAACTGCCGGAGAGTCAAATGACCTGCTCAGCGGGTAACGCCAATTTTGGTATCTGCCACCACCTCGTCGATGGACTCGGTGCAAAGTGCAAAGTGTCATCGAGGTCGTCAATCGAGGTCGTCAATGGCATGCCCAGTACGAAGGATGTTCGTCCCGTCCAGTCCCGTCCAGGAGGTGACAACGTTACAACGTTGACGCTCGACAGGGAAC

Full Affymetrix probeset data:

Annotations for 1630921_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime