FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630922_at:

>probe:Drosophila_2:1630922_at:298:93; Interrogation_Position=1689; Antisense; AGTTCGTACGGATCACCACGTTGTA
>probe:Drosophila_2:1630922_at:592:443; Interrogation_Position=1714; Antisense; GATGTTGTCCATCTGCTTGACATGA
>probe:Drosophila_2:1630922_at:499:509; Interrogation_Position=1747; Antisense; GTGCATTTTGTAGTGCTCAGCCCAT
>probe:Drosophila_2:1630922_at:569:275; Interrogation_Position=1784; Antisense; CTATCGAAGTAGCTCCATGGGTGGA
>probe:Drosophila_2:1630922_at:519:195; Interrogation_Position=1857; Antisense; AACTGGCAATGGTCACGGCGTACAC
>probe:Drosophila_2:1630922_at:623:159; Interrogation_Position=1884; Antisense; ACAACTGCTTGTTTACGTGCTGGCG
>probe:Drosophila_2:1630922_at:10:105; Interrogation_Position=1917; Antisense; AGACGACGTGCTGGAAGGTCTCCCA
>probe:Drosophila_2:1630922_at:689:79; Interrogation_Position=1932; Antisense; AGGTCTCCCAGTTCTTGGCGAAGTA
>probe:Drosophila_2:1630922_at:551:591; Interrogation_Position=2036; Antisense; TGGTGTTGCCACAGCTCGAAGAAGT
>probe:Drosophila_2:1630922_at:270:377; Interrogation_Position=2053; Antisense; GAAGAAGTGCTCCAACATCTCCGGG
>probe:Drosophila_2:1630922_at:85:519; Interrogation_Position=2138; Antisense; GTGGTGAACACATCGTCCTGGTAGA
>probe:Drosophila_2:1630922_at:545:617; Interrogation_Position=2168; Antisense; TGCAGGATCTGGTACATGAACTTCT
>probe:Drosophila_2:1630922_at:475:479; Interrogation_Position=2193; Antisense; GTTTCATCAGAAAGTCCTTGTCCGC
>probe:Drosophila_2:1630922_at:591:425; Interrogation_Position=2248; Antisense; GAGAGTAGCCAGCAATGCCACTGCA

Paste this into a BLAST search page for me
AGTTCGTACGGATCACCACGTTGTAGATGTTGTCCATCTGCTTGACATGAGTGCATTTTGTAGTGCTCAGCCCATCTATCGAAGTAGCTCCATGGGTGGAAACTGGCAATGGTCACGGCGTACACACAACTGCTTGTTTACGTGCTGGCGAGACGACGTGCTGGAAGGTCTCCCAAGGTCTCCCAGTTCTTGGCGAAGTATGGTGTTGCCACAGCTCGAAGAAGTGAAGAAGTGCTCCAACATCTCCGGGGTGGTGAACACATCGTCCTGGTAGATGCAGGATCTGGTACATGAACTTCTGTTTCATCAGAAAGTCCTTGTCCGCGAGAGTAGCCAGCAATGCCACTGCA

Full Affymetrix probeset data:

Annotations for 1630922_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720