FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630923_at:

>probe:Drosophila_2:1630923_at:311:331; Interrogation_Position=2106; Antisense; GCGGACTTGCTCATGGGAATGCTGT
>probe:Drosophila_2:1630923_at:408:233; Interrogation_Position=2123; Antisense; AATGCTGTCCAAACAGCGCTTGTGT
>probe:Drosophila_2:1630923_at:415:727; Interrogation_Position=2142; Antisense; TTGTGTCACCGCCAGTAACAGTGGC
>probe:Drosophila_2:1630923_at:131:155; Interrogation_Position=2168; Antisense; ACAGCCAGTTTATCGCCGGAAATTC
>probe:Drosophila_2:1630923_at:686:559; Interrogation_Position=2185; Antisense; GGAAATTCGCATCGAGTCGCCCAAA
>probe:Drosophila_2:1630923_at:719:53; Interrogation_Position=2213; Antisense; ATGACCGTAGTTCAGCAGGCCACTT
>probe:Drosophila_2:1630923_at:532:69; Interrogation_Position=2229; Antisense; AGGCCACTTTCCAGCCGTACAAGGA
>probe:Drosophila_2:1630923_at:303:391; Interrogation_Position=2260; Antisense; GAAACCCTTCGAGATGTCCGATTTC
>probe:Drosophila_2:1630923_at:140:503; Interrogation_Position=2275; Antisense; GTCCGATTTCTACAAATACTCCACC
>probe:Drosophila_2:1630923_at:100:519; Interrogation_Position=2317; Antisense; GGGCGGAAATCCTAATTGACCTATA
>probe:Drosophila_2:1630923_at:322:541; Interrogation_Position=2343; Antisense; GGTTGTACGGAATTCTCATGCACTT
>probe:Drosophila_2:1630923_at:586:9; Interrogation_Position=2354; Antisense; ATTCTCATGCACTTTCACCTTTTAA
>probe:Drosophila_2:1630923_at:464:111; Interrogation_Position=2430; Antisense; AGCTCAAACTATTGGACTCCTTTCG
>probe:Drosophila_2:1630923_at:466:393; Interrogation_Position=2627; Antisense; GAAATCGCCTTACAACAGGATGCCT

Paste this into a BLAST search page for me
GCGGACTTGCTCATGGGAATGCTGTAATGCTGTCCAAACAGCGCTTGTGTTTGTGTCACCGCCAGTAACAGTGGCACAGCCAGTTTATCGCCGGAAATTCGGAAATTCGCATCGAGTCGCCCAAAATGACCGTAGTTCAGCAGGCCACTTAGGCCACTTTCCAGCCGTACAAGGAGAAACCCTTCGAGATGTCCGATTTCGTCCGATTTCTACAAATACTCCACCGGGCGGAAATCCTAATTGACCTATAGGTTGTACGGAATTCTCATGCACTTATTCTCATGCACTTTCACCTTTTAAAGCTCAAACTATTGGACTCCTTTCGGAAATCGCCTTACAACAGGATGCCT

Full Affymetrix probeset data:

Annotations for 1630923_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720