Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630925_at:

>probe:Drosophila_2:1630925_at:591:547; Interrogation_Position=1041; Antisense; GGATGGCTTCGATCCGCGCGGAAAT
>probe:Drosophila_2:1630925_at:39:397; Interrogation_Position=1096; Antisense; GACACGTTGGATCCGGCGCTCATGC
>probe:Drosophila_2:1630925_at:207:537; Interrogation_Position=1171; Antisense; GGTCGCTCGCACATCTTTAAGATTC
>probe:Drosophila_2:1630925_at:673:679; Interrogation_Position=1250; Antisense; TATGTCCCAACTCGACTGGTGCTGA
>probe:Drosophila_2:1630925_at:337:143; Interrogation_Position=1264; Antisense; ACTGGTGCTGAGATCCGGTCAGTAT
>probe:Drosophila_2:1630925_at:575:139; Interrogation_Position=1291; Antisense; ACGGAAGCGGGCATGTTCGCCATTC
>probe:Drosophila_2:1630925_at:528:299; Interrogation_Position=1319; Antisense; CGCGTCGCAAGGTGGCCACAGAGAA
>probe:Drosophila_2:1630925_at:8:373; Interrogation_Position=1341; Antisense; GAAGGATTTCCTCGAAGCCGTCAAG
>probe:Drosophila_2:1630925_at:38:537; Interrogation_Position=1368; Antisense; GGTTATCAAGAGCTACGCCAAGTTC
>probe:Drosophila_2:1630925_at:409:309; Interrogation_Position=1402; Antisense; CCACGCTACATGACCTACAACTAAG
>probe:Drosophila_2:1630925_at:506:691; Interrogation_Position=1434; Antisense; TATTGGCACTATTCTGTATCCTCTG
>probe:Drosophila_2:1630925_at:404:483; Interrogation_Position=1449; Antisense; GTATCCTCTGCAAACTGTAACACTG
>probe:Drosophila_2:1630925_at:288:143; Interrogation_Position=1462; Antisense; ACTGTAACACTGCAGCTGGCAATTT
>probe:Drosophila_2:1630925_at:114:173; Interrogation_Position=1494; Antisense; AAAGCGAAATCTATACCTCCACCAA

Paste this into a BLAST search page for me
GGATGGCTTCGATCCGCGCGGAAATGACACGTTGGATCCGGCGCTCATGCGGTCGCTCGCACATCTTTAAGATTCTATGTCCCAACTCGACTGGTGCTGAACTGGTGCTGAGATCCGGTCAGTATACGGAAGCGGGCATGTTCGCCATTCCGCGTCGCAAGGTGGCCACAGAGAAGAAGGATTTCCTCGAAGCCGTCAAGGGTTATCAAGAGCTACGCCAAGTTCCCACGCTACATGACCTACAACTAAGTATTGGCACTATTCTGTATCCTCTGGTATCCTCTGCAAACTGTAACACTGACTGTAACACTGCAGCTGGCAATTTAAAGCGAAATCTATACCTCCACCAA

Full Affymetrix probeset data:

Annotations for 1630925_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime