FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630926_at:

>probe:Drosophila_2:1630926_at:564:215; Interrogation_Position=178; Antisense; AAGTTGCGCGGCTACAAGTGTGATA
>probe:Drosophila_2:1630926_at:37:33; Interrogation_Position=200; Antisense; ATAAGTGCCGCGAAATCCGTGCCGA
>probe:Drosophila_2:1630926_at:451:65; Interrogation_Position=260; Antisense; ATGGTTCCTCCTCGGCGGACGAAAT
>probe:Drosophila_2:1630926_at:697:133; Interrogation_Position=368; Antisense; ACGAGCCCGTGTCAATCAAATTGCC
>probe:Drosophila_2:1630926_at:238:163; Interrogation_Position=385; Antisense; AAATTGCCCAAGGTGGAGCCCAAGG
>probe:Drosophila_2:1630926_at:226:417; Interrogation_Position=400; Antisense; GAGCCCAAGGAGACCAGCATGCCGA
>probe:Drosophila_2:1630926_at:57:501; Interrogation_Position=427; Antisense; GTCGGCAACACCATCCTCAAGGATA
>probe:Drosophila_2:1630926_at:541:251; Interrogation_Position=444; Antisense; CAAGGATACCAACAGCAAGCCCATT
>probe:Drosophila_2:1630926_at:238:205; Interrogation_Position=460; Antisense; AAGCCCATTCTCAAGTTCAGTGTCA
>probe:Drosophila_2:1630926_at:441:217; Interrogation_Position=472; Antisense; AAGTTCAGTGTCAGCGCGATCCTTG
>probe:Drosophila_2:1630926_at:521:501; Interrogation_Position=529; Antisense; GTCGATGAGATAGTTTCCTCCAATT
>probe:Drosophila_2:1630926_at:438:103; Interrogation_Position=56; Antisense; AGACCTACACGGAAAGCCAGCTGAA
>probe:Drosophila_2:1630926_at:376:285; Interrogation_Position=76; Antisense; CTGAAGTCCAGCCTGAGCGAGATGC
>probe:Drosophila_2:1630926_at:156:427; Interrogation_Position=94; Antisense; GAGATGCTCCTATCGCGTCGGTCGG

Paste this into a BLAST search page for me
AAGTTGCGCGGCTACAAGTGTGATAATAAGTGCCGCGAAATCCGTGCCGAATGGTTCCTCCTCGGCGGACGAAATACGAGCCCGTGTCAATCAAATTGCCAAATTGCCCAAGGTGGAGCCCAAGGGAGCCCAAGGAGACCAGCATGCCGAGTCGGCAACACCATCCTCAAGGATACAAGGATACCAACAGCAAGCCCATTAAGCCCATTCTCAAGTTCAGTGTCAAAGTTCAGTGTCAGCGCGATCCTTGGTCGATGAGATAGTTTCCTCCAATTAGACCTACACGGAAAGCCAGCTGAACTGAAGTCCAGCCTGAGCGAGATGCGAGATGCTCCTATCGCGTCGGTCGG

Full Affymetrix probeset data:

Annotations for 1630926_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720