FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630929_at:

>probe:Drosophila_2:1630929_at:611:609; Interrogation_Position=305; Antisense; TGACGGCCGCTAGTACTTATCTGAT
>probe:Drosophila_2:1630929_at:586:613; Interrogation_Position=362; Antisense; TGAAGCACAAGATCGCCGGACGGCG
>probe:Drosophila_2:1630929_at:562:225; Interrogation_Position=454; Antisense; AAGGACGAGCGCATCCTGTGGAAGA
>probe:Drosophila_2:1630929_at:589:197; Interrogation_Position=481; Antisense; AACGAGGTAGCCGACTACGAGGCCA
>probe:Drosophila_2:1630929_at:87:579; Interrogation_Position=543; Antisense; GGCCGTTATCATTTTCATCAGCTTC
>probe:Drosophila_2:1630929_at:416:699; Interrogation_Position=568; Antisense; TTTATCCTGAAGAACTCGACGCCGT
>probe:Drosophila_2:1630929_at:70:33; Interrogation_Position=595; Antisense; ATCAACTACATCTTTTCCGTGGGCA
>probe:Drosophila_2:1630929_at:690:607; Interrogation_Position=667; Antisense; TGAGCGAATGTGCAGCCATGTCATC
>probe:Drosophila_2:1630929_at:36:497; Interrogation_Position=686; Antisense; GTCATCCCATGTTCATGTACTCGTA
>probe:Drosophila_2:1630929_at:71:489; Interrogation_Position=702; Antisense; GTACTCGTAATGTAAGGCCCTTCAA
>probe:Drosophila_2:1630929_at:677:563; Interrogation_Position=717; Antisense; GGCCCTTCAAGAGATTTCCTGGTAC
>probe:Drosophila_2:1630929_at:233:3; Interrogation_Position=777; Antisense; ATTGGCGTTTCCAGCAGTGCGAGCA
>probe:Drosophila_2:1630929_at:111:189; Interrogation_Position=820; Antisense; AACACCAACTTGTCTTTCTTGTAGA
>probe:Drosophila_2:1630929_at:372:605; Interrogation_Position=849; Antisense; TGATCAACTTCCATTCGCTGCTGAT

Paste this into a BLAST search page for me
TGACGGCCGCTAGTACTTATCTGATTGAAGCACAAGATCGCCGGACGGCGAAGGACGAGCGCATCCTGTGGAAGAAACGAGGTAGCCGACTACGAGGCCAGGCCGTTATCATTTTCATCAGCTTCTTTATCCTGAAGAACTCGACGCCGTATCAACTACATCTTTTCCGTGGGCATGAGCGAATGTGCAGCCATGTCATCGTCATCCCATGTTCATGTACTCGTAGTACTCGTAATGTAAGGCCCTTCAAGGCCCTTCAAGAGATTTCCTGGTACATTGGCGTTTCCAGCAGTGCGAGCAAACACCAACTTGTCTTTCTTGTAGATGATCAACTTCCATTCGCTGCTGAT

Full Affymetrix probeset data:

Annotations for 1630929_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720