Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630931_at:

>probe:Drosophila_2:1630931_at:696:225; Interrogation_Position=1247; Antisense; AAGGACACTTCAAAGCAGCGCGAGA
>probe:Drosophila_2:1630931_at:292:175; Interrogation_Position=1310; Antisense; AAACGCAGCAGGAGCCGAAGTTCCA
>probe:Drosophila_2:1630931_at:672:371; Interrogation_Position=1350; Antisense; GAAGGATTGCCGAAAGACCGCCTCC
>probe:Drosophila_2:1630931_at:134:711; Interrogation_Position=1400; Antisense; TTAAGCGAAGCCGACCGAGAAGCTC
>probe:Drosophila_2:1630931_at:256:423; Interrogation_Position=1416; Antisense; GAGAAGCTCGCCTGCGCGAAATGAT
>probe:Drosophila_2:1630931_at:480:441; Interrogation_Position=1438; Antisense; GATGGACAACGCCACTTGGAGAGAA
>probe:Drosophila_2:1630931_at:532:519; Interrogation_Position=1478; Antisense; GTGGTTCGCAAGCACCGAGAAGCAT
>probe:Drosophila_2:1630931_at:505:131; Interrogation_Position=1491; Antisense; ACCGAGAAGCATACGCGCGCGAGGA
>probe:Drosophila_2:1630931_at:128:437; Interrogation_Position=1511; Antisense; GAGGAGGCCCAAAATCGTGAACGAG
>probe:Drosophila_2:1630931_at:450:227; Interrogation_Position=1571; Antisense; AAGGCCATTGCCAACCATAACTCAA
>probe:Drosophila_2:1630931_at:156:193; Interrogation_Position=1589; Antisense; AACTCAATTGGCGATCGCATCCGGG
>probe:Drosophila_2:1630931_at:72:523; Interrogation_Position=1611; Antisense; GGGCCAATCTCAACAACATACAGCG
>probe:Drosophila_2:1630931_at:173:229; Interrogation_Position=1648; Antisense; AATGGACAGCAACTTTGCCCGCAAA
>probe:Drosophila_2:1630931_at:705:541; Interrogation_Position=1680; Antisense; GGATTCCTTTATTTCGTATGCATTA

Paste this into a BLAST search page for me
AAGGACACTTCAAAGCAGCGCGAGAAAACGCAGCAGGAGCCGAAGTTCCAGAAGGATTGCCGAAAGACCGCCTCCTTAAGCGAAGCCGACCGAGAAGCTCGAGAAGCTCGCCTGCGCGAAATGATGATGGACAACGCCACTTGGAGAGAAGTGGTTCGCAAGCACCGAGAAGCATACCGAGAAGCATACGCGCGCGAGGAGAGGAGGCCCAAAATCGTGAACGAGAAGGCCATTGCCAACCATAACTCAAAACTCAATTGGCGATCGCATCCGGGGGGCCAATCTCAACAACATACAGCGAATGGACAGCAACTTTGCCCGCAAAGGATTCCTTTATTTCGTATGCATTA

Full Affymetrix probeset data:

Annotations for 1630931_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime