FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630932_at:

>probe:Drosophila_2:1630932_at:648:553; Interrogation_Position=1077; Antisense; GGAGCGAGTTACATCAGACCTGGTG
>probe:Drosophila_2:1630932_at:233:209; Interrogation_Position=1115; Antisense; AAGCAGTGTCCCTTACTATATCTAC
>probe:Drosophila_2:1630932_at:243:687; Interrogation_Position=1131; Antisense; TATATCTACAGTTTCCAAGGGCAAG
>probe:Drosophila_2:1630932_at:335:319; Interrogation_Position=1162; Antisense; GCCGCTTGAGCACTTGTTGATTACT
>probe:Drosophila_2:1630932_at:417:451; Interrogation_Position=631; Antisense; GATCTGATCAAGACACTCACCAACG
>probe:Drosophila_2:1630932_at:638:355; Interrogation_Position=688; Antisense; GCAAAAAGTGCTCTCGCCAAGGAAA
>probe:Drosophila_2:1630932_at:47:123; Interrogation_Position=725; Antisense; AGCGGGAGTCTAGCTGGAGCCATTT
>probe:Drosophila_2:1630932_at:349:699; Interrogation_Position=748; Antisense; TTTAGCGACGTGTTTCTTGTTTCCG
>probe:Drosophila_2:1630932_at:102:99; Interrogation_Position=797; Antisense; AGATGCAGAACTACCTGGTGGGCCA
>probe:Drosophila_2:1630932_at:22:29; Interrogation_Position=843; Antisense; ATACCCAGCTGACATTCATACGGAC
>probe:Drosophila_2:1630932_at:155:543; Interrogation_Position=864; Antisense; GGACTCCAGCCCAGAAGCATTAATT
>probe:Drosophila_2:1630932_at:313:333; Interrogation_Position=912; Antisense; GCTGGACTACTTGCCGCAGGAGATA
>probe:Drosophila_2:1630932_at:101:427; Interrogation_Position=931; Antisense; GAGATACCCTACAACCTTAAGTGCG
>probe:Drosophila_2:1630932_at:642:497; Interrogation_Position=988; Antisense; GTCTACACATCCGTGCAGGTTCAGT

Paste this into a BLAST search page for me
GGAGCGAGTTACATCAGACCTGGTGAAGCAGTGTCCCTTACTATATCTACTATATCTACAGTTTCCAAGGGCAAGGCCGCTTGAGCACTTGTTGATTACTGATCTGATCAAGACACTCACCAACGGCAAAAAGTGCTCTCGCCAAGGAAAAGCGGGAGTCTAGCTGGAGCCATTTTTTAGCGACGTGTTTCTTGTTTCCGAGATGCAGAACTACCTGGTGGGCCAATACCCAGCTGACATTCATACGGACGGACTCCAGCCCAGAAGCATTAATTGCTGGACTACTTGCCGCAGGAGATAGAGATACCCTACAACCTTAAGTGCGGTCTACACATCCGTGCAGGTTCAGT

Full Affymetrix probeset data:

Annotations for 1630932_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720