FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630935_at:

>probe:Drosophila_2:1630935_at:275:239; Interrogation_Position=9377; Antisense; AATTTGCCACCACAGATAACTTCAT
>probe:Drosophila_2:1630935_at:188:671; Interrogation_Position=9450; Antisense; TTACCGGGTGATGTACGTGCAACGT
>probe:Drosophila_2:1630935_at:455:95; Interrogation_Position=9479; Antisense; AGATGTTCGGCGTTTGGACGTCTCT
>probe:Drosophila_2:1630935_at:261:499; Interrogation_Position=9498; Antisense; GTCTCTTTGGTCCTACCTATGGAAC
>probe:Drosophila_2:1630935_at:584:381; Interrogation_Position=9519; Antisense; GAACGAGATTAGCTCCGTGGCTGCA
>probe:Drosophila_2:1630935_at:552:633; Interrogation_Position=9549; Antisense; TCGCGGTGTCCAGTTCACAGTAAAG
>probe:Drosophila_2:1630935_at:25:373; Interrogation_Position=9585; Antisense; GAAGGTACTTGGTCTGTTTAGCAGC
>probe:Drosophila_2:1630935_at:654:175; Interrogation_Position=9652; Antisense; AAACGTGACGCTCTTGTGGACATTA
>probe:Drosophila_2:1630935_at:622:15; Interrogation_Position=9673; Antisense; ATTATAGAATCTCAGCGCTCCGATC
>probe:Drosophila_2:1630935_at:101:301; Interrogation_Position=9720; Antisense; CGCCTATCCGGCTCATAATTGACAA
>probe:Drosophila_2:1630935_at:722:585; Interrogation_Position=9811; Antisense; TGGAAATCTACCTCGATCATCAAGA
>probe:Drosophila_2:1630935_at:54:217; Interrogation_Position=9832; Antisense; AAGATTTTTTCTGTCCAAGCACCGT
>probe:Drosophila_2:1630935_at:599:353; Interrogation_Position=9850; Antisense; GCACCGTGCGCCCAATTGGAAAACT
>probe:Drosophila_2:1630935_at:116:179; Interrogation_Position=9876; Antisense; AAACTTACATGTCGCACTTTTACGT

Paste this into a BLAST search page for me
AATTTGCCACCACAGATAACTTCATTTACCGGGTGATGTACGTGCAACGTAGATGTTCGGCGTTTGGACGTCTCTGTCTCTTTGGTCCTACCTATGGAACGAACGAGATTAGCTCCGTGGCTGCATCGCGGTGTCCAGTTCACAGTAAAGGAAGGTACTTGGTCTGTTTAGCAGCAAACGTGACGCTCTTGTGGACATTAATTATAGAATCTCAGCGCTCCGATCCGCCTATCCGGCTCATAATTGACAATGGAAATCTACCTCGATCATCAAGAAAGATTTTTTCTGTCCAAGCACCGTGCACCGTGCGCCCAATTGGAAAACTAAACTTACATGTCGCACTTTTACGT

Full Affymetrix probeset data:

Annotations for 1630935_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720