Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630936_at:

>probe:Drosophila_2:1630936_at:522:529; Interrogation_Position=1812; Antisense; GGGATCCCCAAGACTCAATGGTTGT
>probe:Drosophila_2:1630936_at:456:541; Interrogation_Position=1831; Antisense; GGTTGTGCCCAAAATCACCGCGGTG
>probe:Drosophila_2:1630936_at:212:487; Interrogation_Position=1860; Antisense; GTAGCTCGAAGCGTCTGGCCAGAAG
>probe:Drosophila_2:1630936_at:546:85; Interrogation_Position=1928; Antisense; AGTGCAACGCACATGATGTCCAGGC
>probe:Drosophila_2:1630936_at:642:123; Interrogation_Position=1956; Antisense; AGCGCACCTCTTCATCGTGCAGAAA
>probe:Drosophila_2:1630936_at:486:113; Interrogation_Position=1985; Antisense; AGCAGCGGTGGAAATGCTCCCTCCA
>probe:Drosophila_2:1630936_at:529:309; Interrogation_Position=2034; Antisense; CCACCGCATCCATATCGAAATCGAA
>probe:Drosophila_2:1630936_at:710:165; Interrogation_Position=2063; Antisense; AAATCGTCAGATGCGGCGAGTGCTC
>probe:Drosophila_2:1630936_at:4:105; Interrogation_Position=2100; Antisense; AGACGTGTGGACGTCGCTACCAAGT
>probe:Drosophila_2:1630936_at:316:673; Interrogation_Position=2117; Antisense; TACCAAGTCCTTGGCACTTTGAGGC
>probe:Drosophila_2:1630936_at:289:259; Interrogation_Position=2131; Antisense; CACTTTGAGGCGTCACATGCGCAAA
>probe:Drosophila_2:1630936_at:411:681; Interrogation_Position=2177; Antisense; TATGTGTGCCGCATGTGCGAACGTC
>probe:Drosophila_2:1630936_at:539:623; Interrogation_Position=2192; Antisense; TGCGAACGTCGTTTCCACTATAATT
>probe:Drosophila_2:1630936_at:649:667; Interrogation_Position=2237; Antisense; TACTATGTGCACAAGGGCGTCCAAA

Paste this into a BLAST search page for me
GGGATCCCCAAGACTCAATGGTTGTGGTTGTGCCCAAAATCACCGCGGTGGTAGCTCGAAGCGTCTGGCCAGAAGAGTGCAACGCACATGATGTCCAGGCAGCGCACCTCTTCATCGTGCAGAAAAGCAGCGGTGGAAATGCTCCCTCCACCACCGCATCCATATCGAAATCGAAAAATCGTCAGATGCGGCGAGTGCTCAGACGTGTGGACGTCGCTACCAAGTTACCAAGTCCTTGGCACTTTGAGGCCACTTTGAGGCGTCACATGCGCAAATATGTGTGCCGCATGTGCGAACGTCTGCGAACGTCGTTTCCACTATAATTTACTATGTGCACAAGGGCGTCCAAA

Full Affymetrix probeset data:

Annotations for 1630936_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime