FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630940_at:

>probe:Drosophila_2:1630940_at:243:183; Interrogation_Position=110; Antisense; AAAACGCAATACACAATGCTGCTCA
>probe:Drosophila_2:1630940_at:232:53; Interrogation_Position=13; Antisense; ATGAAATACTTTGTGGTCCTTGTCG
>probe:Drosophila_2:1630940_at:90:281; Interrogation_Position=131; Antisense; CTCAAGTGGGAATTGGCTTTGCTAA
>probe:Drosophila_2:1630940_at:308:363; Interrogation_Position=140; Antisense; GAATTGGCTTTGCTAAGCCCTTTGA
>probe:Drosophila_2:1630940_at:151:619; Interrogation_Position=150; Antisense; TGCTAAGCCCTTTGAAAAATTGATC
>probe:Drosophila_2:1630940_at:44:29; Interrogation_Position=18; Antisense; ATACTTTGTGGTCCTTGTCGTCCTG
>probe:Drosophila_2:1630940_at:229:627; Interrogation_Position=29; Antisense; TCCTTGTCGTCCTGGCCCTCATTTT
>probe:Drosophila_2:1630940_at:642:303; Interrogation_Position=45; Antisense; CCTCATTTTGGCCATCAGCGTGGGT
>probe:Drosophila_2:1630940_at:574:13; Interrogation_Position=49; Antisense; ATTTTGGCCATCAGCGTGGGTCCTT
>probe:Drosophila_2:1630940_at:721:261; Interrogation_Position=60; Antisense; CAGCGTGGGTCCTTCGGATGCAGTA
>probe:Drosophila_2:1630940_at:370:531; Interrogation_Position=66; Antisense; GGGTCCTTCGGATGCAGTATTTATT
>probe:Drosophila_2:1630940_at:40:505; Interrogation_Position=68; Antisense; GTCCTTCGGATGCAGTATTTATTGA
>probe:Drosophila_2:1630940_at:31:351; Interrogation_Position=79; Antisense; GCAGTATTTATTGATATTCTTGACA
>probe:Drosophila_2:1630940_at:319:3; Interrogation_Position=94; Antisense; ATTCTTGACAAAGTGGAAAACGCAA

Paste this into a BLAST search page for me
AAAACGCAATACACAATGCTGCTCAATGAAATACTTTGTGGTCCTTGTCGCTCAAGTGGGAATTGGCTTTGCTAAGAATTGGCTTTGCTAAGCCCTTTGATGCTAAGCCCTTTGAAAAATTGATCATACTTTGTGGTCCTTGTCGTCCTGTCCTTGTCGTCCTGGCCCTCATTTTCCTCATTTTGGCCATCAGCGTGGGTATTTTGGCCATCAGCGTGGGTCCTTCAGCGTGGGTCCTTCGGATGCAGTAGGGTCCTTCGGATGCAGTATTTATTGTCCTTCGGATGCAGTATTTATTGAGCAGTATTTATTGATATTCTTGACAATTCTTGACAAAGTGGAAAACGCAA

Full Affymetrix probeset data:

Annotations for 1630940_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720