Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630942_at:

>probe:Drosophila_2:1630942_at:633:61; Interrogation_Position=2362; Antisense; ATGTCCAATCTGCAGAATTGCTTGC
>probe:Drosophila_2:1630942_at:483:363; Interrogation_Position=2376; Antisense; GAATTGCTTGCTGATAGCCACGTTG
>probe:Drosophila_2:1630942_at:179:443; Interrogation_Position=2441; Antisense; GATGTTGTCCAATATCCGATCGTTT
>probe:Drosophila_2:1630942_at:321:305; Interrogation_Position=2502; Antisense; CCTTTCCGTGTTTAGTGCAATTTCA
>probe:Drosophila_2:1630942_at:701:169; Interrogation_Position=2587; Antisense; AAAGAATCCACGTAACCGCTTGAAG
>probe:Drosophila_2:1630942_at:330:161; Interrogation_Position=2624; Antisense; ACAATTGCGTTCTTCTTCTACTTAG
>probe:Drosophila_2:1630942_at:529:449; Interrogation_Position=2669; Antisense; GATCGCAAAACCATTTCCATTTCGC
>probe:Drosophila_2:1630942_at:89:307; Interrogation_Position=2693; Antisense; CCTTTCCTCGCAATAGTCTCAAGTA
>probe:Drosophila_2:1630942_at:226:195; Interrogation_Position=2733; Antisense; AACTGAGACCAGCAGCTTCACAAAT
>probe:Drosophila_2:1630942_at:447:17; Interrogation_Position=2803; Antisense; ATTTAGTTCCATCTTAGCCAATTAT
>probe:Drosophila_2:1630942_at:143:417; Interrogation_Position=2840; Antisense; GAGCGTCTGTACTTGCTTTGTATTT
>probe:Drosophila_2:1630942_at:288:181; Interrogation_Position=2875; Antisense; AAAACCAGCTAGCACCGATTTAGTT
>probe:Drosophila_2:1630942_at:629:695; Interrogation_Position=2893; Antisense; TTTAGTTTCGGTTCGCATTGCTTTG
>probe:Drosophila_2:1630942_at:521:719; Interrogation_Position=2915; Antisense; TTGCTGTGATTTTGCCCTCTTTAAA

Paste this into a BLAST search page for me
ATGTCCAATCTGCAGAATTGCTTGCGAATTGCTTGCTGATAGCCACGTTGGATGTTGTCCAATATCCGATCGTTTCCTTTCCGTGTTTAGTGCAATTTCAAAAGAATCCACGTAACCGCTTGAAGACAATTGCGTTCTTCTTCTACTTAGGATCGCAAAACCATTTCCATTTCGCCCTTTCCTCGCAATAGTCTCAAGTAAACTGAGACCAGCAGCTTCACAAATATTTAGTTCCATCTTAGCCAATTATGAGCGTCTGTACTTGCTTTGTATTTAAAACCAGCTAGCACCGATTTAGTTTTTAGTTTCGGTTCGCATTGCTTTGTTGCTGTGATTTTGCCCTCTTTAAA

Full Affymetrix probeset data:

Annotations for 1630942_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime