FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630945_at:

>probe:Drosophila_2:1630945_at:88:693; Interrogation_Position=4187; Antisense; TTTGTTTGTTTTCCTATCAGAAGTA
>probe:Drosophila_2:1630945_at:543:649; Interrogation_Position=4203; Antisense; TCAGAAGTAATGTGGCGCCTTCACA
>probe:Drosophila_2:1630945_at:413:321; Interrogation_Position=4217; Antisense; GCGCCTTCACAACTGATTCCAATAA
>probe:Drosophila_2:1630945_at:339:61; Interrogation_Position=4270; Antisense; ATGTAATTTGTATCGTGCTCACGCA
>probe:Drosophila_2:1630945_at:48:651; Interrogation_Position=4288; Antisense; TCACGCATTTTAAGCGCTCGGATGA
>probe:Drosophila_2:1630945_at:611:425; Interrogation_Position=4377; Antisense; GAGTAATTACCTAAGTCTAAGCTAT
>probe:Drosophila_2:1630945_at:654:1; Interrogation_Position=4400; Antisense; ATTAGTGTCATAGAACCGTACGAAG
>probe:Drosophila_2:1630945_at:643:377; Interrogation_Position=4412; Antisense; GAACCGTACGAAGAGTTTGCGAATA
>probe:Drosophila_2:1630945_at:258:659; Interrogation_Position=4451; Antisense; TAAGAGGAATCCTTAACGACTTTCT
>probe:Drosophila_2:1630945_at:109:199; Interrogation_Position=4465; Antisense; AACGACTTTCTTAATGACTGCCATA
>probe:Drosophila_2:1630945_at:81:155; Interrogation_Position=4573; Antisense; ACAGCAGGGAATATCGTAGCAAATT
>probe:Drosophila_2:1630945_at:217:649; Interrogation_Position=4628; Antisense; TCAAATCTCGAATGCTTGTAAACAT
>probe:Drosophila_2:1630945_at:202:115; Interrogation_Position=4657; Antisense; AGCAGTATCAACTTTTCTTGTTAAC
>probe:Drosophila_2:1630945_at:503:263; Interrogation_Position=4716; Antisense; CAGTTTTACTAACCTTTTCTAGCAT

Paste this into a BLAST search page for me
TTTGTTTGTTTTCCTATCAGAAGTATCAGAAGTAATGTGGCGCCTTCACAGCGCCTTCACAACTGATTCCAATAAATGTAATTTGTATCGTGCTCACGCATCACGCATTTTAAGCGCTCGGATGAGAGTAATTACCTAAGTCTAAGCTATATTAGTGTCATAGAACCGTACGAAGGAACCGTACGAAGAGTTTGCGAATATAAGAGGAATCCTTAACGACTTTCTAACGACTTTCTTAATGACTGCCATAACAGCAGGGAATATCGTAGCAAATTTCAAATCTCGAATGCTTGTAAACATAGCAGTATCAACTTTTCTTGTTAACCAGTTTTACTAACCTTTTCTAGCAT

Full Affymetrix probeset data:

Annotations for 1630945_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720