Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630949_s_at:

>probe:Drosophila_2:1630949_s_at:61:293; Interrogation_Position=1005; Antisense; CGTACCCTTTGTGCGCAGCAGGAAA
>probe:Drosophila_2:1630949_s_at:216:23; Interrogation_Position=1082; Antisense; ATATCAAGCGATCTGAATGCGTCCG
>probe:Drosophila_2:1630949_s_at:293:661; Interrogation_Position=1108; Antisense; TAAACGCTGCCCAGCAGGTTTTGTG
>probe:Drosophila_2:1630949_s_at:361:329; Interrogation_Position=1137; Antisense; GCGTCTGGCGCAACACAACAGGTTT
>probe:Drosophila_2:1630949_s_at:227:49; Interrogation_Position=668; Antisense; ATGTACCTGTGGTGTTGGTCGGCAA
>probe:Drosophila_2:1630949_s_at:281:209; Interrogation_Position=694; Antisense; AAGATCGATCTCCACCAGGAACGAA
>probe:Drosophila_2:1630949_s_at:52:613; Interrogation_Position=765; Antisense; TGCATTTCTCGAAACGTCCGCCAAA
>probe:Drosophila_2:1630949_s_at:528:495; Interrogation_Position=780; Antisense; GTCCGCCAAACAGAACGAGTCCGTG
>probe:Drosophila_2:1630949_s_at:716:271; Interrogation_Position=817; Antisense; CATCAGCTACTGATCCTCATCGAAA
>probe:Drosophila_2:1630949_s_at:669:235; Interrogation_Position=853; Antisense; AATCCCCAGGAGAAGAGCGGTTGTC
>probe:Drosophila_2:1630949_s_at:574:725; Interrogation_Position=873; Antisense; TTGTCTTGTATCGTAGGGCGGCTGA
>probe:Drosophila_2:1630949_s_at:447:671; Interrogation_Position=899; Antisense; TAGCTAAAACTACGGCCGAACTGTT
>probe:Drosophila_2:1630949_s_at:197:165; Interrogation_Position=926; Antisense; AAATACGGCAAATCGCTATGGCAAT
>probe:Drosophila_2:1630949_s_at:647:275; Interrogation_Position=968; Antisense; CTTATCTACACAGTTGGGTCAGCGT

Paste this into a BLAST search page for me
CGTACCCTTTGTGCGCAGCAGGAAAATATCAAGCGATCTGAATGCGTCCGTAAACGCTGCCCAGCAGGTTTTGTGGCGTCTGGCGCAACACAACAGGTTTATGTACCTGTGGTGTTGGTCGGCAAAAGATCGATCTCCACCAGGAACGAATGCATTTCTCGAAACGTCCGCCAAAGTCCGCCAAACAGAACGAGTCCGTGCATCAGCTACTGATCCTCATCGAAAAATCCCCAGGAGAAGAGCGGTTGTCTTGTCTTGTATCGTAGGGCGGCTGATAGCTAAAACTACGGCCGAACTGTTAAATACGGCAAATCGCTATGGCAATCTTATCTACACAGTTGGGTCAGCGT

Full Affymetrix probeset data:

Annotations for 1630949_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime