Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630950_at:

>probe:Drosophila_2:1630950_at:28:261; Interrogation_Position=1252; Antisense; CACGCGTGTTGATGCCTTTGGCGAA
>probe:Drosophila_2:1630950_at:72:307; Interrogation_Position=1266; Antisense; CCTTTGGCGAAGAGGCTACCTTTGA
>probe:Drosophila_2:1630950_at:479:565; Interrogation_Position=1279; Antisense; GGCTACCTTTGAGCTAGGAGCGGCT
>probe:Drosophila_2:1630950_at:138:679; Interrogation_Position=1293; Antisense; TAGGAGCGGCTCACAAGGTTAAACT
>probe:Drosophila_2:1630950_at:158:473; Interrogation_Position=1310; Antisense; GTTAAACTGGAGTCTCGGCTGCGAC
>probe:Drosophila_2:1630950_at:527:433; Interrogation_Position=1340; Antisense; GAGGAGGGCAACCTGCGCAAACTCT
>probe:Drosophila_2:1630950_at:662:433; Interrogation_Position=1415; Antisense; GAGGTGTTCACCTACCAACCAGAGG
>probe:Drosophila_2:1630950_at:505:435; Interrogation_Position=1436; Antisense; GAGGCCGACAACACCTTGAACGTGA
>probe:Drosophila_2:1630950_at:725:375; Interrogation_Position=1462; Antisense; GAAGAAGCGCAAGCACTCCGAGTCC
>probe:Drosophila_2:1630950_at:460:431; Interrogation_Position=1481; Antisense; GAGTCCGAACAGCAGACGCCTGTTA
>probe:Drosophila_2:1630950_at:729:435; Interrogation_Position=1625; Antisense; GAGGATCAGCCAACACCAGCAAAGA
>probe:Drosophila_2:1630950_at:496:109; Interrogation_Position=1665; Antisense; AGCACCAGGAGTAATTTCCCACCTT
>probe:Drosophila_2:1630950_at:199:17; Interrogation_Position=1678; Antisense; ATTTCCCACCTTGACTAGTTAGTAG
>probe:Drosophila_2:1630950_at:305:485; Interrogation_Position=1699; Antisense; GTAGGCCTTAAGTTTTAGCATCATA

Paste this into a BLAST search page for me
CACGCGTGTTGATGCCTTTGGCGAACCTTTGGCGAAGAGGCTACCTTTGAGGCTACCTTTGAGCTAGGAGCGGCTTAGGAGCGGCTCACAAGGTTAAACTGTTAAACTGGAGTCTCGGCTGCGACGAGGAGGGCAACCTGCGCAAACTCTGAGGTGTTCACCTACCAACCAGAGGGAGGCCGACAACACCTTGAACGTGAGAAGAAGCGCAAGCACTCCGAGTCCGAGTCCGAACAGCAGACGCCTGTTAGAGGATCAGCCAACACCAGCAAAGAAGCACCAGGAGTAATTTCCCACCTTATTTCCCACCTTGACTAGTTAGTAGGTAGGCCTTAAGTTTTAGCATCATA

Full Affymetrix probeset data:

Annotations for 1630950_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime