Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630952_at:

>probe:Drosophila_2:1630952_at:658:25; Interrogation_Position=1030; Antisense; ATAGTCACGTAAATGCTTGCGCAGC
>probe:Drosophila_2:1630952_at:632:545; Interrogation_Position=545; Antisense; GGATCGCTACAAGGAACACCGCAAG
>probe:Drosophila_2:1630952_at:91:277; Interrogation_Position=656; Antisense; CTTCTCCGGCTTCGGTGGATCAAAG
>probe:Drosophila_2:1630952_at:653:561; Interrogation_Position=692; Antisense; GGAACTAAGTGTTGAACTGCCCCTC
>probe:Drosophila_2:1630952_at:244:301; Interrogation_Position=717; Antisense; CCCTCCAATTTTAGCTGTACCATGA
>probe:Drosophila_2:1630952_at:316:389; Interrogation_Position=746; Antisense; GAAACTAACCACAAGACGACGCGTC
>probe:Drosophila_2:1630952_at:450:137; Interrogation_Position=761; Antisense; ACGACGCGTCTAGTTTAGCTTGTGA
>probe:Drosophila_2:1630952_at:363:93; Interrogation_Position=813; Antisense; AGTTCAGAAGACACCAGCTACCCGG
>probe:Drosophila_2:1630952_at:624:671; Interrogation_Position=831; Antisense; TACCCGGCTGTTCCCAGTTAGAATA
>probe:Drosophila_2:1630952_at:655:657; Interrogation_Position=902; Antisense; TAAATCTAAGCATACGGCCGTGGAT
>probe:Drosophila_2:1630952_at:409:291; Interrogation_Position=920; Antisense; CGTGGATCACCTGCGGAATGAGCTT
>probe:Drosophila_2:1630952_at:619:679; Interrogation_Position=944; Antisense; TAGGTGAACACAAATCCCTGCTCAG
>probe:Drosophila_2:1630952_at:266:593; Interrogation_Position=969; Antisense; TGGGTATGTCCCACGGCATGGTAAA
>probe:Drosophila_2:1630952_at:537:347; Interrogation_Position=984; Antisense; GCATGGTAAAGAACTCCCCGGGCAG

Paste this into a BLAST search page for me
ATAGTCACGTAAATGCTTGCGCAGCGGATCGCTACAAGGAACACCGCAAGCTTCTCCGGCTTCGGTGGATCAAAGGGAACTAAGTGTTGAACTGCCCCTCCCCTCCAATTTTAGCTGTACCATGAGAAACTAACCACAAGACGACGCGTCACGACGCGTCTAGTTTAGCTTGTGAAGTTCAGAAGACACCAGCTACCCGGTACCCGGCTGTTCCCAGTTAGAATATAAATCTAAGCATACGGCCGTGGATCGTGGATCACCTGCGGAATGAGCTTTAGGTGAACACAAATCCCTGCTCAGTGGGTATGTCCCACGGCATGGTAAAGCATGGTAAAGAACTCCCCGGGCAG

Full Affymetrix probeset data:

Annotations for 1630952_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime