FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630953_at:

>probe:Drosophila_2:1630953_at:656:27; Interrogation_Position=346; Antisense; ATACGCGTAGGCAACACTCCGGAAA
>probe:Drosophila_2:1630953_at:677:315; Interrogation_Position=382; Antisense; GCCTTTGTCGTCTACGAGGACATTT
>probe:Drosophila_2:1630953_at:483:401; Interrogation_Position=400; Antisense; GACATTTTCGATGCCAAGAACGCCT
>probe:Drosophila_2:1630953_at:45:107; Interrogation_Position=416; Antisense; AGAACGCCTGTGACCATTTATCGGG
>probe:Drosophila_2:1630953_at:624:235; Interrogation_Position=454; Antisense; AATCGCTATCTGGTGGTGCTCTACT
>probe:Drosophila_2:1630953_at:336:509; Interrogation_Position=469; Antisense; GTGCTCTACTACCAATCCAACAAGG
>probe:Drosophila_2:1630953_at:161:187; Interrogation_Position=487; Antisense; AACAAGGCCTTCAAGCGCGTGGACA
>probe:Drosophila_2:1630953_at:196:615; Interrogation_Position=560; Antisense; TGAAGACGCCTGAAGCTCCTTAGAA
>probe:Drosophila_2:1630953_at:185:705; Interrogation_Position=579; Antisense; TTAGAACCCACACTTGGTGCGGCAG
>probe:Drosophila_2:1630953_at:356:709; Interrogation_Position=655; Antisense; TTCCATCGACCATTTTCCATTGTTT
>probe:Drosophila_2:1630953_at:573:705; Interrogation_Position=678; Antisense; TTAGGGAACTTCTTGCTCTGCTTAT
>probe:Drosophila_2:1630953_at:37:49; Interrogation_Position=783; Antisense; ATCCATCACTCCATCTATCATATAA
>probe:Drosophila_2:1630953_at:681:539; Interrogation_Position=844; Antisense; GGTTCCGACTGTTTGCAATCATTTG
>probe:Drosophila_2:1630953_at:697:409; Interrogation_Position=868; Antisense; GACGACATTAAGACACTCTCTCATC

Paste this into a BLAST search page for me
ATACGCGTAGGCAACACTCCGGAAAGCCTTTGTCGTCTACGAGGACATTTGACATTTTCGATGCCAAGAACGCCTAGAACGCCTGTGACCATTTATCGGGAATCGCTATCTGGTGGTGCTCTACTGTGCTCTACTACCAATCCAACAAGGAACAAGGCCTTCAAGCGCGTGGACATGAAGACGCCTGAAGCTCCTTAGAATTAGAACCCACACTTGGTGCGGCAGTTCCATCGACCATTTTCCATTGTTTTTAGGGAACTTCTTGCTCTGCTTATATCCATCACTCCATCTATCATATAAGGTTCCGACTGTTTGCAATCATTTGGACGACATTAAGACACTCTCTCATC

Full Affymetrix probeset data:

Annotations for 1630953_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720