FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630955_at:

>probe:Drosophila_2:1630955_at:463:493; Interrogation_Position=1063; Antisense; GTAATCTGGATTTTCGCTGTCTCCC
>probe:Drosophila_2:1630955_at:200:285; Interrogation_Position=1079; Antisense; CTGTCTCCCTAAGCCTAATTGTGAT
>probe:Drosophila_2:1630955_at:539:277; Interrogation_Position=1104; Antisense; CTACGCGTTCTTCTTTGAGCTGAAA
>probe:Drosophila_2:1630955_at:616:47; Interrogation_Position=1188; Antisense; ATCCTTGCCCACCTTTGTTGAAAGT
>probe:Drosophila_2:1630955_at:105:383; Interrogation_Position=1221; Antisense; GAACGGTCTGACTCACTTCATGATC
>probe:Drosophila_2:1630955_at:16:647; Interrogation_Position=1238; Antisense; TCATGATCTCCAATTTCCTTACGGG
>probe:Drosophila_2:1630955_at:58:369; Interrogation_Position=1262; Antisense; GAATGGTCAACATGTCCCTGAACCC
>probe:Drosophila_2:1630955_at:621:613; Interrogation_Position=1280; Antisense; TGAACCCGGGTCATCGAAGTGATCT
>probe:Drosophila_2:1630955_at:534:499; Interrogation_Position=1308; Antisense; GTCTGTTGTTATACTGTCCATCTAT
>probe:Drosophila_2:1630955_at:402:287; Interrogation_Position=1346; Antisense; CTGGAGTGGTCTTCCTTATGCTAAA
>probe:Drosophila_2:1630955_at:505:369; Interrogation_Position=853; Antisense; GAAGGCTTAAGTTCCCTACACGGAT
>probe:Drosophila_2:1630955_at:99:443; Interrogation_Position=875; Antisense; GATGTGTGGCTCTCTATTTGCTCAG
>probe:Drosophila_2:1630955_at:667:221; Interrogation_Position=913; Antisense; AAGTGGTATACTTCCCGTGATAGCC
>probe:Drosophila_2:1630955_at:671:209; Interrogation_Position=967; Antisense; AAGAGTATTCTTTTCGTGGCCATTC

Paste this into a BLAST search page for me
GTAATCTGGATTTTCGCTGTCTCCCCTGTCTCCCTAAGCCTAATTGTGATCTACGCGTTCTTCTTTGAGCTGAAAATCCTTGCCCACCTTTGTTGAAAGTGAACGGTCTGACTCACTTCATGATCTCATGATCTCCAATTTCCTTACGGGGAATGGTCAACATGTCCCTGAACCCTGAACCCGGGTCATCGAAGTGATCTGTCTGTTGTTATACTGTCCATCTATCTGGAGTGGTCTTCCTTATGCTAAAGAAGGCTTAAGTTCCCTACACGGATGATGTGTGGCTCTCTATTTGCTCAGAAGTGGTATACTTCCCGTGATAGCCAAGAGTATTCTTTTCGTGGCCATTC

Full Affymetrix probeset data:

Annotations for 1630955_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720