FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630956_at:

>probe:Drosophila_2:1630956_at:197:729; Interrogation_Position=396; Antisense; TTGGGTGCGTCTTAACTTGAGCCAC
>probe:Drosophila_2:1630956_at:664:625; Interrogation_Position=422; Antisense; TGCCAGCGAGCTATGCCGAAAGGAT
>probe:Drosophila_2:1630956_at:251:21; Interrogation_Position=480; Antisense; ATTTGGCGCCATTTTCGAATCCAGT
>probe:Drosophila_2:1630956_at:699:207; Interrogation_Position=497; Antisense; AATCCAGTTTGGCTACGGTGTACAT
>probe:Drosophila_2:1630956_at:391:533; Interrogation_Position=582; Antisense; GGTGGTCTACAAATACTCATCGATG
>probe:Drosophila_2:1630956_at:169:575; Interrogation_Position=606; Antisense; GGCGGATGATCTGTTCTTTAGCGAA
>probe:Drosophila_2:1630956_at:691:79; Interrogation_Position=671; Antisense; AGTGTCCCAAGTACTATACCATCTC
>probe:Drosophila_2:1630956_at:410:681; Interrogation_Position=697; Antisense; TATGTGATGCCGAGGGATTCGCCAT
>probe:Drosophila_2:1630956_at:600:719; Interrogation_Position=754; Antisense; TTCCTGAATGCTGGACTGATTGTCA
>probe:Drosophila_2:1630956_at:632:241; Interrogation_Position=826; Antisense; AATATCCTGGAAGCCGATGCCGAAT
>probe:Drosophila_2:1630956_at:307:201; Interrogation_Position=848; Antisense; AATCCGAGCTTGTGAGGGTCCTAAC
>probe:Drosophila_2:1630956_at:195:345; Interrogation_Position=885; Antisense; GCAGTTGGCCTTCTACGTGGTTATC
>probe:Drosophila_2:1630956_at:498:637; Interrogation_Position=908; Antisense; TCGGTGGTAATTTGTTGGCTTTTCT
>probe:Drosophila_2:1630956_at:209:645; Interrogation_Position=939; Antisense; TCTAGCCGAGCATTTCAGGTGGAAA

Paste this into a BLAST search page for me
TTGGGTGCGTCTTAACTTGAGCCACTGCCAGCGAGCTATGCCGAAAGGATATTTGGCGCCATTTTCGAATCCAGTAATCCAGTTTGGCTACGGTGTACATGGTGGTCTACAAATACTCATCGATGGGCGGATGATCTGTTCTTTAGCGAAAGTGTCCCAAGTACTATACCATCTCTATGTGATGCCGAGGGATTCGCCATTTCCTGAATGCTGGACTGATTGTCAAATATCCTGGAAGCCGATGCCGAATAATCCGAGCTTGTGAGGGTCCTAACGCAGTTGGCCTTCTACGTGGTTATCTCGGTGGTAATTTGTTGGCTTTTCTTCTAGCCGAGCATTTCAGGTGGAAA

Full Affymetrix probeset data:

Annotations for 1630956_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720